The inhibition effect of psoralen on prostate cancer PC3 cells via down-regulation of long non-coding RNA ENST00000510619
Highlight box
Key findings
• Psoralen could inhibit PC3 cells in a concentration- and time-dependent manner and had a cell cycle blocking effect on PC3 cells.
• The microarray analysis results revealed the complex molecular mechanism of psoralen involving multiple differentially expressed long non-coding RNAs (lncRNAs) and messenger RNAs (mRNAs).
• Psoralen could down-regulate the expression of lncRNA ENST00000510619 in a concentration-dependent manner.
• The inhibition effect of psoralen on the malignant biological behaviors of PC3 cells might be achieved via the down-regulation of lncRNA ENST00000510619.
What is known and what is new?
• Psoralen, one of the major compounds of fructus psoraleae, has been reported to have anti-cancer properties for various tumors. To date, there have been limited reports regarding psoralen’s potential anti-prostate cancer (PCa) properties. LncRNA ENST00000510619 is a novel lncRNA located on Chromosome 11: 35,212,550-35,214,007 forward strand. The function of this lncRNA remains unknown.
• Psoralen can inhibit androgen-independent PCa cells in vitro. This is the first exploration of the functionality of lncRNA ENST00000510619, and the findings suggest its role in the inhibition of PCa by psoralen.
What is the implication, and what should change now?
• This study provides the experimental basis for the development of psoralen as a novel anti-PCa drug and for the consideration of lncRNA ENST00000510619 as a potential clinical target for PCa.
• In vivo experiments on psoralen in the treatment of PCa and the target genes of lncRNA ENST00000510619 as well as its specific function need to be further studied.
Introduction
Prostate cancer (PCa) is the second most common cancer in men, affecting millions of men worldwide (1). Radical prostatectomy, external-beam radiotherapy, and brachytherapy are available curative treatments for localized PCa, but some patients present with metastatic PCa and forfeit the opportunity for curative treatment (2). Endocrine therapy for advanced PCa is effective, but the disease eventually progresses to castration-resistant prostate cancer (CRPC) and becomes refractory to treatment (2,3). New treatment techniques or medications are needed to improve outcomes and quality of life in patients with CRPC.
Psoralen, one of the major compounds of fructus psoraleae, has been reported to have anti-cancer properties for various tumors, including breast cancer, mucoepidermoid cancer, and bladder cancer, and can reverse multi-drug resistance of cancer cells (4-7). It has been demonstrated to induce anti-proliferation, cell cycle arrest, apoptosis, and differentiation of cancer cells in vitro (5), and is therefore viewed as a promising anti-tumor drug (6). Scaffidi et al. (8) reported that an X-ray-activated anticancer “nanodrug” composed of yttrium oxide (Y2O3) nanoscintillators and psoralen could yield concentration-dependent reductions in cell numbers of PC3, a human androgen-independent prostate carcinoma cell line. However, there are limited reports about psoralen treatment in the field of PCa and the anti-tumor mechanism of psoralen has not been fully elucidated.
Long non-coding RNAs (lncRNAs) are transcripts with a length of at least 200 nucleotides and no or low protein translation (9). They comprise the majority part of transcripts in the mammalian transcriptome and are considered to widely participate in the cellular biological functions, including metabolism, proliferation, and apoptosis (10,11). Accumulating evidence has revealed the close relationship of lncRNAs with cancer development and progression (12). Several lncRNAs have been demonstrated to play important biological roles in tumor development and progression of PCa (13-15). Some of these lncRNAs act as PCa growth inhibitors or promoters, while the functions of others remain unknown (15-18). Existing researches indicate that lncRNAs may serve as promising therapeutic targets of PCa in the future, but only a few have been sufficiently validated (13,19). Further investigations are required to characterize the critical lncRNAs involved in PCa treatment, and to explore their functional role and molecular mechanisms.
In order to explore the effect of psoralen on PC3 cells and the potential underlying mechanisms, we observed the inhibition of psoralen on PC3 cell proliferation and performed microarray analysis to identify differentially expressed lncRNAs and messenger RNAs (mRNAs), so as to reveal the potential functional involvement of lncRNAs in psoralen treatment for PCa. Furthermore, based on the results of microarray analysis, down-regulation of lncRNA ENST00000510619 and psoralen on the malignant biological behaviors of PC3 cells were detected by Cell Counting Kit-8 (CCK-8) test, transwell assay and wound healing. The aim of this study was to find a novel potential antitumor drug and potential targets for the treatment of CRPC. We present this article in accordance with the MDAR reporting checklist (available at https://tau.amegroups.com/article/view/10.21037/tau-24-457/rc).
Methods
Cell culture and chemicals
Human PC3 cells were provided by Prof. Yinghao Sun (Center of Prostate Disease, Naval Military Medical University, China). PC3 cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 (HyClone, Logan, UT, USA) supplemented with 10% fetal bovine serum (FBS; HyClone, USA) in a humidified atmosphere with 5% carbon dioxide at 37 ℃. Psoralen (Xiya, Shandong, China) was dissolved in 100% dimethyl sulfoxide (DMSO) (Sigma-Aldrich, St. Louis, MO, USA) at a concentration of 33.33 mg/mL before being diluted with cell culture medium to achieve various concentrations.
Cell proliferation assay
Exponentially growing PC3 cells (3,000 cells) were trypsinized and seeded in 96-well plates and allowed to adhere to the plate overnight. To determine the influence of psoralen on PC3 cells, the experimental groups (each group contained 6 wells) were treated with 0 (containing 0.3% DMSO), 10, 30, 50, and 100 µg/mL psoralen for 24, 48, 72, and 96 hours, respectively. To determine the influence of down-regulation of lncRNA ENST00000510619 expression in the proliferation inhibition of prostate on PC3 cells, the experimental groups included PC3 cells and PC3 cells with small interfering lncRNA (si-lncRNA) ENST00000510619. After the treatment, CCK-8 (MedChemExpress, Monmouth Junction, NJ, USA) was used to assess cell viability. The cell culture medium of each well was replaced with 100 µL fresh medium containing 10 µL CCK-8 solution for 1 hour. Absorbance at 450 nm was measured using a microplate reader (Thermo Fisher Scientific, Waltham, MA, USA). A total of three independent experiments were performed. Cell viability was calculated as the percentage of the absorbance of the experimental group to the absorbance of the control group.
Cell cycle analysis
PC3 cells were cultured with 0, 10, 30, 50, and 100 µg/mL psoralen for 24 hours. Approximately 2×106 cells per dish were collected, fixed in 70% ethanol at 4 ℃ for 2 hours, then washed with phosphate-buffered saline (PBS), stained with 50 µg/mL propidium iodide (PI; Sigma, USA) in the dark for 30 min, and finally detected by FACSAria flow cytometry [Becton, Dickinson, and Co. (BD), Franklin Lakes, NJ, USA].
Microarray analysis
PC3 cells were seeded in 90 mm dishes and allowed to attach overnight. The psoralen group was stimulated with 50 µg/mL psoralen for 48 hours and the control group was stimulated with 0.15% DMSO for 48 hours. SBC Human (4×180 k) lncRNA microarrays (V6.0, Shanghai Biotechnology Corporation, Shanghai, China) were used in this research to detect 29,857 coding transcripts and 91,007 lncRNAs. The microarray scan data were extracted with Agilent Feature Extraction Software v10.7.3 (Agilent Technology, Santa Clara, CA, USA). Raw data were normalized with the quantile algorithm in the Gene Spring software (Agilent Technology, USA).
Bioinformatics analysis
All differentially expressed mRNAs were selected for Gene Ontology (GO) analysis (http://www.geneontology.org) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses (http://www.genome.ad.jp/kegg/) to explore the potential functions and pathways involved in the inhibition of psoralen on PC3 cells. GO analysis was used in functional enrichment studies to categorize the roles of mRNAs into three domains: cellular component (CC), molecular function (MF), and biological process (BF). KEGG analysis was used to reveal potential biological pathways associated with differentially expressed genes (DEGs). The function of differentially expressed lncRNAs were predicted via cis- or trans-regulatory effects using the GO and KEGG databases.
Cell transfection
si-lncRNA ENST00000510619 (5'-GUUCUGCUCUCAUUUAUUATT-3') and si-NC (5'-UUCUCCGAACGUGUCACGUTT-3') were synthesized by Sangon Biotech (Shanghai, China). A population of 1×106 PC-3 cells was cultivated in 6-well plates without antibiotics for 24 hours. Hieff Trans® Liposomal Transfection Reagent (Yeasen Biotechnology, Shanghai, China) was used for transfection. si-lncRNA ENST00000510619 and the blank control (si-NC) were separately transfected into the PC-3 cell lines, and a fresh culture medium was provided after 6 hours. Cell collection for subsequent experiments occurred 48 h after the transfection.
Real-time quantitative polymerase chain reaction (RT-qPCR)
There were three parts of experiments using RT-qPCR for the measurement of target genes in each group. (I) Microarray data validation: five differentially expressed lncRNAs and five differentially expressed mRNAs were randomly selected and determined. PC3 cells were treated and grouped as “Microarray analysis”. (II) The effect of psoralen on the expression of lncRNA ENST000000510619 in PC3 cells: PC-3 cells were cultured and exposed to various concentrations of psoralen (0, 10, 30, 50, and 100 µg/mL) for 48 hours. Subsequently, the expression levels of lncRNA ENST00000510619 in PC-3 cells were determined. (III) Transfection efficiency evaluation of si-lncRNA ENST000000510619: PC3 cells were divided into the control group (si-NC) and the transfection group (si-lncRNA ENST000000510619). Total RNA was extracted from the cells with TransZol Up and RNA Extraction Agent (TransGen Biotech, Beijing, China). The complementary DNA (cDNA) synthesis involved 5× HiScript II qRT SuperMix II (Vazyme Biotech, Nanjing, China). The qRT-PCR was performed by Hieff UNICON® Universal Blue qPCR SYBR Green Master Mix (Yeasen Biotechnology, Shanghai, China) to estimate the expression of target genes. Relative expressions of target genes were normalized to the β-actin mRNA level using the 2-△△Ct method. The primer sequences used are listed in Table 1.
Table 1
| Gene | Forward primer (5'→3') | Reverse primer (5'→3') |
|---|---|---|
| lncRNA | ||
| NR-104586 | CGGATTGTGAGGGTGAAACT | ACAGTATGCCTCGTGTGCAG |
| NR-027632 | TTTCAGAGCTGGCATTTCCT | TCCATCAACGGCAGTCATTA |
| NR-125375 | ATGGCCACATACAGGAGGAG | GAGCTGAACCTGAAGGATGC |
| NR-036512 | GTCCCTGTGTGAGCAGAGGT | CCAACTCGCAAACCTCAAGT |
| NR-024399 | TTGGTTGATGCATTTGGAGA | AGGAAAGATGGCAGCACTGT |
| ENST00000510619 | ACATGCTTGGCCTCATTTCTCTG | 5CTAAGGAGTGTAAGGGGCTTTGTC |
| mRNA | ||
| NM-015392 | GACTCAGAAGGCCGACTACG | CGTGAAGTCTCCGTCCTCAT |
| NM-198075 | AGGGACAGACTTGGAGAGCA | CAGCTTCAGTTGGTCCAGGT |
| NM-001142522 | TGAGGTTGCCAAGACATTGA | GAGGAGCTTGCCATCTGAAC |
| NM-001288653 | AACCGCCTTGCAGAGTTAGA | TTTCCTAGCCCCATCAACAG |
| NM-016343 | GTGGCAACAGAAGCTGACAA | TCTTCTGTGTCGATGCCAAG |
| β-actin | GTTGTCGACGACGAGCG | GCACAGAGCCTCGCCTT |
RT-qPCR, real-time quantitative polymerase chain reaction; lncRNAs, long non-coding RNAs; mRNAs, messenger RNAs.
Transwell assay and wound healing
The experimental groups included PC3 cells, PC3 cells with si-lncRNA ENST00000510619, and PC3 cells treated with 50 µg/mL psoralen. The transwell assay was conducted with a 24-well transwell chamber with 8-μm pore size (Corning, Corning, NY, USA) and Basement Membrane Matrix (Phenol Red; Thermo Fisher, USA) to assess cellular invasion in PC‐3 cells from different groups. Specifically, a population of 1×105 PC3 cells of each group was seeded in the top chamber with serum-free medium, while the medium containing 10% FBS was added to the lower chamber. After a 24-hour incubation period, the migrated cells were counted with a microscope. For wound healing assay, the cellular monolayer was delicately abraded with pipette tips to create distinct wound gaps. Sequential images were captured at the intervals of 0 and 12 hours with an inverted microscope.
Statistical analysis
We independently performed three biological replicates for all experiments. All data were analyzed using SPSS 17.0 (IBM Corp., Chicago, IL, USA), ModFit LT 9verity software House, Bedford, MA, USA) and R software 4.3.0 (R Foundation for Statistical Computing, Vienna, Austria). Differences between the groups were analyzed using one-way analysis of variance (ANOVA) or Student’s t-test, as appropriate. In the microarray analysis, fold changes (FCs) of >2 and P values <0.05 were used to determine statistical significance in comparisons of the differential expressions of lncRNAs and mRNAs between the two groups. The pathways with a P value <0.05 were defined as those significantly enriched in DEGs.
Results
Effect of psoralen on PC3 cell proliferation and cell cycle in vitro
CCK-8 test indicated that the growth of PC3 cells was significantly inhibited by psoralen in a concentration- and time-dependent manner (Figure 1A). Cell viability of the PC3 cells gradually decreased as the psoralen concentrations increased and the culture time extended. Flow cytometry test demonstrated that psoralen caused G0/G1 phase and G2/M phase cycle arrests in PC3 cells, and this inhibitory effect gradually became evident with increasing psoralen concentration (Figure 1B, Table 2).
Table 2
| Phase | Psoralen concentration | F value | P value | ||||
|---|---|---|---|---|---|---|---|
| Control | 10 μg/mL | 30 μg/mL | 50 μg/mL | 100 μg/mL | |||
| G0/G1 phase | 39.10±2.82 | 45.84±1.60 | 48.03±1.19 | 52.80±2.65 | 56.80±1.43 | 32.696 | <0.001 |
| S phase | 58.34±3.09 | 50.59±1.21 | 48.02±0.29 | 40.42±4.51 | 32.31±1.35 | 44.746 | <0.001 |
| G2/M phase | 2.57±1.92 | 3.56±1.84 | 3.95±1.44 | 6.77±1.95 | 10.89±2.50 | 8.894 | 0.002 |
Data presented as mean ± standard deviation.
Differentially expressed lncRNAs and mRNAs
Based on the results of the cell proliferation assay, microarray analysis was used to identify the differentially expressed lncRNAs and mRNAs involved in PC3 cells treated with 50 µg/mL psoralen for 48 hours. Hierarchical clustering was applied to group lncRNAs and mRNAs based on their expression levels (Figure 2A,2B). In the scatter plot and volcano plot, 91,007 lncRNAs and 29,857 mRNAs were represented. When screened with a FC of ≥2.0 and a P value of <0.05, 1,716 lncRNAs and 1,160 mRNAs were significantly up-regulated (red plots), whereas 3,269 lncRNAs and 3,263 mRNAs were significantly down-regulated (blue plots) (Figure 2). The top 10 downregulated lncRNAs in which the signal of the probe showed significant differences compared to the background are shown in Table 3. Among them, lncRNA ENST00000510619 had the highest FC and was selected for further investigation.
Table 3
| Name | P values | Fold change | Regulation |
|---|---|---|---|
| ENST00000510619 | 0.001 | 9.690960827 | Down |
| lnc-GLI3-4:1 | <0.001 | 8.588433743 | Down |
| lnc-TSPY2-5:1 | 0.004 | 8.512423262 | Down |
| lnc-C3orf80-2:1 | <0.001 | 8.386712135 | Down |
| lnc-PCDH11X-1:1 | 0.003 | 8.159451492 | Down |
| lnc-KIAA1524-2:1 | 0.002 | 7.95494635 | Down |
| lnc-C3orf80-3:1 | <0.001 | 7.417104105 | Down |
| lnc-PDHX-4:1 | 0.003 | 6.98756201 | Down |
| lnc-MC5R-1:2 | 0.001 | 6.840549068 | Down |
| lnc-MTF2-3:1 | 0.004 | 6.764208274 | Down |
lncRNAs, long non-coding RNAs.
Bioinformatics analysis of differentially expressed mRNAs and lncRNAs
GO analysis showed that a total of 663 items were correlated with the differentially expressed mRNAs, which were classified into three categories: BPs (468 items), CCs (88 items), and MF (107 items). The top 30 enriched GO items of differentially expressed mRNAs are shown in Figure 3A. As shown in Figure 3B, the KEGG results showed that the differentially expressed mRNAs were enriched in 22 pathways.
We used GO database data and KEGG database to predict target genes of differentially expressed lncRNAs, including cis-target genes and trans-target genes. In the cis-target gene prediction, a total of 705 items were found, including 495 BP-related items, 94 CC-related items, and 116 MF-related items. The trans-target gene prediction results showed 181 items, including 40 BP-related items, 19 CC-related items, and 122 MF-related items. KEGG pathway enrichment analysis showed that 18 cis-target pathways were predicted, including homologous recombination, cell cycle, endocytosis, and so on. The trans-target pathway predicts 15 pathways, including lysosome, D-glutamine and glutamic acid metabolism, sphingolipid biosynthetic spheres, heterologous spheres, and so on. The KEGG enriched cis-/trans-target signaling pathways are shown in Figure 4A,4B.
RT-qPCR validation of the microarray analysis and determination of the influence of psoralen on lncRNA ENST00000510619 expression in PC3 cells
We randomly selected five differentially expressed lncRNAs (NR-104586, NR-027632, NR-125375, NR-036512, and NR-024399) and five differentially expressed mRNAs (NM-015392, NM-198075, NM-001142522, NM-001288653, and NM-016343) for RT-qPCR to verify the reliability of the results of the microarray data. The RT-qPCR results showed the same trend as the microarray data (Figure 5A,5B). Besides, the expression of lncRNA ENST00000510619 in PC-3 cells was shown to be down-regulated by psoralen in a concentration-dependent manner, as determined by RT-qPCR (Figure 5C).
Effects of psoralen and down-regulation of lncRNA ENST00000510619 on the malignant biological behaviors of PC3 cells
As determined by RT-qPCR, the expression of lncRNA ENST00000510619 in PC3 cells was significantly down-regulated after the transfection of si-lncRNA ENST00000510619, which indicated the successful construction of si-lncRNA ENST00000510619 PC-3 cells through the si-RNA technology (Figure 6A). CCK-8 test showed that the cell viability of PC3 cells with si-lncRNA ENST00000510619 transfection was inhibited when compared with normal PC3 cells (Figure 6B). Transwell assay and wound healing were conducted to assess the invasion ability and migratory ability of PC3 cells, respectively. The invasion ability (Figure 6C) and migration activity (Figure 6D) of PC3 cells were both significantly inhibited by psoralen and si-lncRNA ENST00000510619 transfection.
Discussion
In this study, psoralen was confirmed to have an inhibitory effect on the proliferation of PC3 cells. The CCK-8 experiments demonstrated that the inhibition of psoralen on PC3 cells was both time- and concentration-dependent. The flow cytometry test demonstrated that psoralen had a cell cycle blocking effect on PC3 cells in a concentration-dependent manner. Psoralen was observed to cause G1 phase and G2/M phase cycle arrest in PC3 cells.
To further elucidate the molecular mechanism of psoralen’s inhibition on PC3 cell proliferation, microarray analysis was conducted to compare the comprehensive lncRNA and mRNA expression profiles between PC3 cells and PC3 cells treated with psoralen. Based on results of the CCK-8 experiment and the flow cytometry test, the concentration of 50 µg/mL of psoralen and the action time of 48 hours were chosen for the subsequent microarray analysis. The results showed that a total of 4,985 lncRNAs and 4,423 mRNAs were significantly differentially expressed between the two groups with a difference of more than two-fold. KEGG pathway enrichment analysis of differentially expressed mRNAs showed 22 significantly related signaling pathways, including the p38 MAPK signaling pathway, mTOR pathway, p53 pathway, and cell cycle pathway, which have been previously reported to be associated with the development and the treatment of PCa (20-26). Previous studies concerning psoralen on other tumors showed that the anti-tumor mechanisms of psoralen include induction of tumor cell apoptosis and inhibition of tumor cell proliferation and migration (5,27,28). Taken together, our findings indicated that the underlying mechanism of action of psoralen on PC3 cell inhibition may be complex and involve multiple pathways.
LncRNAs are a large cluster of regulators widely expressed with diverse functions, and their cellular localizations vary distinctly (9-11). Accumulating reports have revealed that lncRNAs play critical role in tumorigenesis and tumor development through cis- and trans-regulation of other genes (29,30). LncRNAs can exert function through different mechanisms, such as transcriptional interference and epigenetic silence of gene clusters (12,31). Some lncRNAs were demonstrated as titrating miRNAs through acting as a sponge, resulting in the post-transcriptional alteration of target proteins (32). We used the GO database to predict cis-target genes and trans-target genes of differentially expressed lncRNAs. The results showed 705 items in the cis-target gene prediction and 181 items in the trans-target gene prediction. KEGG pathway enrichment analysis showed that 18 cis-target pathways and 15 trans-target pathways were predicted. Previously, there has been no study on the role of lncRNAs in psoralen’s anti-tumor. Our results indicate that lncRNAs are of great importance in the course of psoralen inhibiting the proliferation of PC3 cells. The differentially expressed lncRNAs identified in the present study can provide potential targets for further functional study of lncRNAs in the inhibition of psoralen on PCa.
Among the differentially down-regulated lncRNAs in which the signal of the probe showed significant differences compared to the background, lncRNA ENST00000510619 had the highest differential expression FC. According to the database of Ensembl (https://asia.ensembl.org/index.html), lncRNA ENST00000510619 is a novel lncRNA located on Chromosome 11: 35,212,550-35,214,007 forward strand. The function of this lncRNA remains unknown. In the present study, we further explored the relationship between lncRNA ENST00000510619 and psoralen’s inhibition on PCa, as well as the effect of lncRNA ENST00000510619 on PC3 cells. The RT-qPCR results showed psoralen could down-regulate the expression of lncRNA ENST00000510619 in a concentration-dependent manner, which indicated the potential underlying role of lncRNA ENST00000510619 for PC3 cell inhibition by psoralen. We then used siRNA technology to reduce the expression of lncRNA ENST00000510619 in PC3 cells. The CCK-8 test results showed that transfection of si-lncRNA ENST00000510619 could significantly decrease the viability of PC3 cells. The transwell test and the wound healing test showed that both psoralen and transfection with si-lncRNA ENST00000510619 could significantly inhibit cell invasion ability and migration activity. These results together indicate that effects of psoralen on the malignant biological behavior of PC3 cells may be achieved by down-regulating the expression of lncRNA ENST00000510619. This is the first exploration of the functionality of the novel lncRNA, and the findings suggested its role in the inhibition of psoralen in PCa.
Conclusions
Psoralen can inhibit PC3 cells in a concentration- and time-dependent manner and has a cell cycle blocking effect on PC3 cells. This study provides the experimental evidence for the development of psoralen as a novel anti-CRPC drug. The microarray analysis revealed the complex molecular mechanism of psoralen involving multiple differentially expressed lncRNAs and mRNAs. Psoralen can down-regulate the expression of lncRNA ENST00000510619 in a concentration-dependent manner. The inhibition effect of psoralen on the malignant biological behaviors of PC3 cells may be achieved via the down-regulation of lncRNA ENST00000510619. This is the first exploration of the function of lncRNA ENST00000510619, and the results provide the experimental basis for the consideration of lncRNA ENST00000510619 as a potential clinical target for CRPC. Otherwise, there are limitations in this study. First, this is an in vitro study, and there is a lack of in vivo experiments. Second, the results were obtained from the bioinformatics analysis only. The DEGs and their roles need to be further confirmed. Third, the target genes of lncRNA ENST00000510619 and its specific function need to be further studied.
Acknowledgments
Funding: The present study was supported by
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tau.amegroups.com/article/view/10.21037/tau-24-457/rc
Data Sharing Statement: Available at https://tau.amegroups.com/article/view/10.21037/tau-24-457/dss
Peer Review File: Available at https://tau.amegroups.com/article/view/10.21037/tau-24-457/prf
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tau.amegroups.com/article/view/10.21037/tau-24-457/coif). R.K.S. receives consulting fees from Johnson & Johnson, outside the submitted work. The other authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Bray F, Ferlay J, Soerjomataram I, et al. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2018;68:394-424. [Crossref] [PubMed]
- Rebello RJ, Oing C, Knudsen KE, et al. Prostate cancer. Nat Rev Dis Primers 2021;7:9. [Crossref] [PubMed]
- Shimodaira K, Nakashima J, Nakagami Y, et al. Prognostic Value of Platelet Counts in Patients with Metastatic Prostate Cancer Treated with Endocrine Therapy. Urol J 2020;17:42-9. [PubMed]
- Wang X, Cheng K, Han Y, et al. Effects of Psoralen as an Anti-tumor Agent in Human Breast Cancer MCF-7/ADR Cells. Biol Pharm Bull 2016;39:815-22. [Crossref] [PubMed]
- Wang X, Xu C, Hua Y, et al. Psoralen induced cell cycle arrest by modulating Wnt/β-catenin pathway in breast cancer cells. Sci Rep 2018;8:14001. [Crossref] [PubMed]
- Thakur A, Sharma R, Jaswal VS, et al. Psoralen: A Biologically Important Coumarin with Emerging Applications. Mini Rev Med Chem 2020;20:1838-45. [Crossref] [PubMed]
- Yuan Y, Cai T, Callaghan R, et al. Psoralen-loaded lipid-polymer hybrid nanoparticles enhance doxorubicin efficacy in multidrug-resistant HepG2 cells. Int J Nanomedicine 2019;14:2207-18. [Crossref] [PubMed]
- Scaffidi JP, Gregas MK, Lauly B, et al. Activity of psoralen-functionalized nanoscintillators against cancer cells upon X-ray excitation. ACS Nano 2011;5:4679-87. [Crossref] [PubMed]
- Karakas D, Ozpolat B. The Role of LncRNAs in Translation. Noncoding RNA 2021; [Crossref] [PubMed]
- Zhang X, Wang W, Zhu W, et al. Mechanisms and Functions of Long Non-Coding RNAs at Multiple Regulatory Levels. Int J Mol Sci 2019; [Crossref] [PubMed]
- Mowel WK, Kotzin JJ, McCright SJ, et al. Control of Immune Cell Homeostasis and Function by lncRNAs. Trends Immunol 2018;39:55-69. [Crossref] [PubMed]
- Vafadar A, Shabaninejad Z, Movahedpour A, et al. Long Non-Coding RNAs As Epigenetic Regulators in Cancer. Curr Pharm Des 2019;25:3563-77. [Crossref] [PubMed]
- Ghiam AF, Vesprini D, Liu SK. Long non-coding RNAs: new frontiers for advancing personalized cancer medicine in prostate cancer. Transl Androl Urol 2017;6:326-30. [Crossref] [PubMed]
- Misawa A, Takayama KI, Inoue S. Long non-coding RNAs and prostate cancer. Cancer Sci 2017;108:2107-14. [Crossref] [PubMed]
- An C, Wang I, Li X, et al. Long non-coding RNA in prostate cancer. Am J Clin Exp Urol 2022;10:170-9. [PubMed]
- Hu J, Deng J, Cao R, et al. LncRNA GAS5 participates in the regulation of dexamethasone on androgen receptor -negative and -positive prostate cancer cell proliferation. Mol Cell Probes 2020;53:101607. [Crossref] [PubMed]
- Shukla S, Zhang X, Niknafs YS, et al. Identification and Validation of PCAT14 as Prognostic Biomarker in Prostate Cancer. Neoplasia 2016;18:489-99. [Crossref] [PubMed]
- Pal G, Huaman J, Levine F, et al. Long Noncoding RNA from PVT1 Exon 9 Is Overexpressed in Prostate Cancer and Induces Malignant Transformation and Castration Resistance in Prostate Epithelial Cells. Genes (Basel) 2019; [Crossref] [PubMed]
- de Kok JB, Verhaegh GW, Roelofs RW, et al. DD3(PCA3), a very sensitive and specific marker to detect prostate tumors. Cancer Res 2002;62:2695-8. [PubMed]
- Hamid AA, Gray KP, Shaw G, et al. Compound Genomic Alterations of TP53, PTEN, and RB1 Tumor Suppressors in Localized and Metastatic Prostate Cancer. Eur Urol 2019;76:89-97. [Crossref] [PubMed]
- Ben-Salem S, Venkadakrishnan VB, Heemers HV. Novel insights in cell cycle dysregulation during prostate cancer progression. Endocr Relat Cancer 2021;28:R141-55. [Crossref] [PubMed]
- Shen KH, Hung SH, Yin LT, et al. Acacetin, a flavonoid, inhibits the invasion and migration of human prostate cancer DU145 cells via inactivation of the p38 MAPK signaling pathway. Mol Cell Biochem 2010;333:279-91. [Crossref] [PubMed]
- Robinson D, Van Allen EM, Wu YM, et al. Integrative Clinical Genomics of Advanced Prostate Cancer. Cell 2015;162:454. [Crossref] [PubMed]
- Xue L, Han X, Liu R, et al. MDM2 and P53 polymorphisms contribute together to the risk and survival of prostate cancer. Oncotarget 2016;7:31825-31. [Crossref] [PubMed]
- Torrealba N, Vera R, Fraile B, et al. TGF-β/PI3K/AKT/mTOR/NF-kB pathway. Clinicopathological features in prostate cancer. Aging Male 2020;23:801-11. [Crossref] [PubMed]
- Feng FY, Zhang Y, Kothari V, et al. MDM2 Inhibition Sensitizes Prostate Cancer Cells to Androgen Ablation and Radiotherapy in a p53-Dependent Manner. Neoplasia 2016;18:213-22. [Crossref] [PubMed]
- Li S, Tu H. Psoralen inhibits the proliferation and promotes apoptosis through endoplasmic reticulum stress in human osteosarcoma cells. Folia Histochem Cytobiol 2022;60:101-9. [Crossref] [PubMed]
- Wang X, Peng P, Pan Z, et al. Psoralen inhibits malignant proliferation and induces apoptosis through triggering endoplasmic reticulum stress in human SMMC7721 hepatoma cells. Biol Res 2019;52:34. [Crossref] [PubMed]
- Jiang B, Yuan Y, Yi T, et al. The Roles of Antisense Long Noncoding RNAs in Tumorigenesis and Development through Cis-Regulation of Neighbouring Genes. Biomolecules 2023;13:684. [Crossref] [PubMed]
- Li W, Xu C, Guo J, et al. Cis- and Trans-Acting Expression Quantitative Trait Loci of Long Non-Coding RNA in 2,549 Cancers With Potential Clinical and Therapeutic Implications. Front Oncol 2020;10:602104. [Crossref] [PubMed]
- Nadhan R, Isidoro C, Song YS, et al. Signaling by LncRNAs: Structure, Cellular Homeostasis, and Disease Pathology. Cells 2022; [Crossref] [PubMed]
- Ma G, Tang M, Wu Y, et al. LncRNAs and miRNAs: potential biomarkers and therapeutic targets for prostate cancer. Am J Transl Res 2016;8:5141-50. [PubMed]

