Long non-coding RNA (lncRNA) XIST drives TGF-β-induced renal cancer progression via miR-141-3p/ZEB1 signaling
Highlight box
Key findings
• Transforming growth factor beta (TGF-β) upregulates long non-coding RNA (lncRNA) X inactive-specific transcript (XIST), and XIST knockdown suppresses proliferation, epithelial-mesenchymal transition (EMT), migration, and invasion, while promoting apoptosis in TGF-β-stimulated 786-O and Caki-1 cells. Mechanistically, XIST sponges microRNA-141-3p (miR-141-3p, and zinc-finger E-box binding protein 1 (ZEB1) overexpression reverses the miR-141-3p mimic-mediated suppression of malignant behaviors.
What is known and what is new?
• TGF-β is a key driver of EMT and metastasis in renal cancer (RC). LncRNA XIST has been associated with tumor progression in various malignancies. MiR-141-3p acts as a tumor suppressor in multiple cancer types.
• This study showed that XIST promotes TGF-β‑induced RC malignant progression through the miR-141-3p/ZEB1 axis.
What is the implication, and what should change now?
• The XIST/miR-141-3p/ZEB1 axis represents a promising therapeutic target for TGF-β‑driven RC. Targeted interventions aimed at inhibiting XIST or restoring miR-141-3p expression may suppress RC metastasis and improve patient outcomes.
• Further studies should explore the clinical applicability of this axis as a biomarker for RC diagnosis and prognosis assessment.
Introduction
As a urinary malignancy, renal cancer (RC) primarily (~90%) develops from renal parenchymal tissue (1). The global incidence of RC continues to increase each year, with tobacco use, advancing age, obesity, and hypertension recognized as major risk factors (2). Due to its insidious nature and vague or absent symptoms at onset, the early detection of RC remains challenging (3). Current diagnostic approaches for RC predominantly include sonography (4), urinalysis (5), computed tomography (6), tumor marker expression assessment (7), and other diagnostic modalities (8). However, an optimal early diagnostic and screening protocol has yet to be established (9).
Current treatment strategies for RC typically involve early surgical resection followed by chemotherapy. Immunotherapy has also emerged as a promising treatment approach, leveraging patient-derived immune responses to eliminate cancer cells (10). Compared with traditional chemotherapy and targeted therapies, immunotherapy may provide more durable responses and improve overall survival (11). Emerging evidence suggests that serum albumin levels may predict outcomes in patients with advanced RC receiving immune checkpoint blockade therapy (12). Currently, the key immune checkpoint inhibitors (ICIs) used in RC management include anti-programmed cell death protein 1/programmed death-ligand 1 antibodies and cytotoxic T-lymphocyte-associated protein 4 blockers (13,14). However, reliable prognostic and predictive biomarkers for evaluating ICI response in RC have yet to be validated in clinical practice (15). To date, no robust biomarkers have been clinically confirmed to predict ICI response or survival outcomes in RC patients (16). Postoperative metastasis and recurrence rates also remain high, significantly affecting patient survival (17). Therefore, the key molecules involved in the progression of RC need to be identified to improve the diagnosis, treatment, and prognosis of RC patients.
Transforming growth factor beta (TGF-β), a pleiotropic cytokine, plays a critical role in driving epithelial-mesenchymal transition (EMT), enhancing cellular plasticity, and promoting metastasis and therapy resistance across diverse malignancies (18). Various cells can secrete TGF-β in an inactive state (19). In tumor microcirculation, TGF-β has been shown to initiate metastatic processes in RC cells (20). Further, TGF-β has been implicated in promoting RC cell proliferation, neovascularization, and immunosuppression (21,22), thereby contributing to RC progression, particularly metastasis. This study aimed to further investigate the role of TGF-β in RC cell metastasis.
Long non-coding RNAs (lncRNAs) are a class of non-coding RNAs, typically exceeding 200 nucleotides in length and lacking protein-coding capacity (23). Most lncRNAs are transcribed by RNA polymerase (24). Among them, lncRNA X inactive-specific transcript (XIST), a transcription product of chromosome Xq13.2, has been shown to suppress the activation of X chromosome-associated genes (25). Accumulating evidence indicates that XIST functions as an active lncRNA (26,27). Recent research has revealed an association between XIST and clinical outcomes in patients diagnosed with RC (28). However, the specific role and underlying molecular mechanisms of XIST in RC remain unclear.
Competitive endogenous RNAs (ceRNAs) are transcripts that regulate each other by competing for shared microRNA (miRNA or miR) binding sites (29). Through ceRNA networks, lncRNAs serve as miRNA decoys, thereby disrupting the post-transcriptional regulation of target genes and promoting tumor progression (30). To explore whether XIST functions analogously in renal cell carcinoma (RCC), in silico prediction was conducted to map its interacting miRNAs. Among the candidates, microRNA-141-3p (miR-141-3p) was identified as a potential binding partner of XIST. Previous research has characterized miR-141-3p as a negative regulator of cancer aggressiveness in oral squamous cell carcinoma (31), clear cell renal carcinoma (32), colonic malignancy (33), and other tumors (34). However, the question of whether XIST antagonizes miR-141-3p activity to drive RCC progression remains unclear and warrants further investigation.
This study aimed to investigate the role of XIST in RC cell proliferation, apoptosis, and metastasis, and examine the regulatory relationship between XIST and miR-141-3p. The study findings may provide novel insights into potential therapeutic targets for RC treatment. We present this article in accordance with the MDAR reporting checklist (available at https://tau.amegroups.com/article/view/10.21037/tau-2026-0536/rc).
Methods
Cell culture
Human RCC cell lines 786-O (catalog #CC1503) and Caki-1 (catalog #CC1501) were commercially purchased from CellCook (Guangzhou, China), while 293T cells (catalog #CRL-3216) were sourced from the American Type Culture Collection (Manassas, VA, USA). All cells were tested and were confirmed to be free of mycoplasma contamination. For routine culture, the 786-O cells were grown in Roswell Park Memorial Institute 1640 (Gibco, Grand Island, NY, USA) supplemented with 2 mM L-glutamine (IG0390, Solarbio, Beijing, China), 10% fetal bovine serum (FBS; Gibco), and penicillin-streptomycin solution (100 IU/mL and 100 µg/mL, respectively; Sigma-Aldrich, St. Louis, MO, USA). The Caki-1 cells were cultured in McCoy’s 5A medium (Invitrogen, Waltham, MA, USA), supplemented with 10% FBS and penicillin-streptomycin. For 293T cell maintenance, Dulbecco’s Modified Eagle’s Medium (Gibco, USA), supplemented with 10% FBS and penicillin-streptomycin, was used. All cells were incubated at 37 ℃ in a humidified atmosphere containing 5% carbon dioxide (CO2). All cell lines were verified against the International Cell Line Authentication Committee (ICLAC) Register of Misidentified Cell Lines and confirmed to be authentic.
Cell treatment
For TGF-β stimulation, the 786-O and Caki-1 cells were treated with 10 ng/mL recombinant TGF-β (catalog #RP00161; ABCLONAL) for 0, 7, 14, and 21 days. Small-interfering RNAs (siRNAs) targeting XIST (si-XIST), negative-control siRNAs (si-NC), and miR-141-3p inhibitors and mimics were commercially synthesized by Gene-Seed (Guangzhou, China). The following siRNA sequences were used: si-XIST-1, 5'-UCAGGUGUCCAUAUUUGCAGCUAUU-3' (sense), 5'-AAUAGCUGCAAAUAUGGACACCUGA-3' (antisense); si-XIST-2, 5'-CAAGGCCCUUUCUCUUGGACUUAAA-3' (sense), 5'-UUUAAGUCCAAGAGAAAGGGCCUUG-3' (antisense); si-XIST-3, 5'-CCCUUUCUCUUGGACUUAAACAAUU-3' (sense), 5'-AAUUGUUUAAGUCCAAGAGAAAGGG-3' (antisense); si-NC, 5'-ACGUGACACGUUCGGAGAAUU-3' (sense), 5'-UUCUCCGAACGUGUCACGUUU-3' (antisense). miR-141-3p inhibitor sequences: 5'-CCAUCUUUACCAGACAGUGUUA-3'; inhibitor-NC sequences: 5'-ACUACCUUAGGAUUUCAAUCCG-3'; miR-141-3p mimics sequences: 5'-UAACACUGUCUGGUAAAGAUGG-3' (sense), 5'-CCAUCUUUACCAGACAGUGUUA-3' (antisense); mimics-NC sequences: 5'-UUGAACAGAGGCUAUCUAGGUA-3' (sense), 5'-UACCUAGAUAGCCUCUGUUCAA-3' (antisense). The plasmid overexpressing zinc-finger E-box binding protein 1 (ZEB1) was obtained from Miaolingbio (Wuhan, China). The 786-O and Caki-1 cells were seeded into 6-well plates to approximately 70% confluency and transfected using Lipofectamine 3000 (Invitrogen). Cell culture plates were randomly allocated to treatment groups.
Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)
Total RNA was isolated from cells using TriQuick Reagent (R1100, Solarbio). For complementary DNA synthesis, 100 ng of total RNA was reverse-transcribed using HiScript III RT SuperMix (R323-01, Vazyme Biotechnology, Nanjing, China) in accordance with the manufacturer’s instructions. Real-time polymerase chain reaction (PCR) was subsequently performed using ChamQ Universal SYBR qPCR Master Mix (Q711-02, Novozymes, Nangjing, China) in a 20 µL reaction volume. The cycling parameters consisted of an initial denaturation step at 95 ℃ for 2 min, followed by 40 cycles of 95 ℃ for 15 s and 60 ℃ for 30 s. The relative expression levels of the target gene were calculated using the 2−ΔΔCt method. The primers sequences are listed in Table 1, and were obtained from Sangon Biotech (Shanghai, China). The RT-qPCR experiments were conducted in accordance with the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines.
Table 1
| Gene name | Primer sequences (5'–3') |
|---|---|
| miR-141-3p RT | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACccatct |
| miR-141-3p-F | TAACACTGTCTGGTAA |
| Universe-R | GTGCAGGGTCCGAGGT |
| XIST-F | ATGCTGACTACCCAAAGCCC |
| XIST-R | GCACCAACACACCAAAGTGG |
| H-ZEB1-F182 | AGGTGTACCAGAGGATGACCT |
| H-ZEB1-R182 | ACTCGCATTCATCATCTTTTACTGT |
| H-GAPDH-F | GAGTCAACGGATTTGGTCGT |
| H-GAPDH-R | GACAAGCTTCCCGTTCTCAG |
| hsa-U6-F | CTCGCTTCGGCAGCACA |
| hsa-U6-R | AACGCTTCACGAATTTGCGT |
RT-qPCR, reverse transcription-quantitative polymerase chain reaction.
MTT assay
The 786-O and Caki-1 cells (1×104 cells/well) were seeded into 96-well plates. After cell adherence, the cells were treated as required for the experiment. Each group included six replicates. Subsequently 10 µL of 20 mM 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) solution (IM0280, Solarbio) was added to each well and incubated at 37 ℃ for 3 h. The resulting violet formazan crystals were solubilized with 200 µL dimethyl sulfoxide (DMSO) (Sigma-Aldrich). After complete dissolution, absorbance was measured using a microplate reader at 570 nm.
Flow cytometry
The treated 786-O and Caki-1 cells were harvested and resuspended in precooled phosphate-buffered saline (PBS; Invitrogen). A total of 1×106 cells were incubated with 5 µL Annexin-fluorescein isothiocyanate (FITC) (556570, BD Bioscience, CA, USA) and 5 µL propidium iodide (556570, BD Bioscience) at 4 ℃. Flow cytometry (BD Biosciences) was used to assess the apoptosis rate. FlowJo was used to analyze the data.
Western blot analysis
Western blot analysis was performed to assess the expression of ZEB1 (1:5,000, 21544-1-AP, Proteintech, Wuhan, China), N-cadherin (Proteintech, 22018-1-AP, 1:20,000), Vimentin (Proteintech, 10366-1-AP, 1:20,000), and Snail (ABclonal, A11794, 1:800). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH; Proteintech, 60004-1-Ig, 1:50,000) served as the loading control. Protein (20 µg/lane) was used in our study. The procedure followed standard western blot protocols. All antibodies were validated for use in human cell lines according to the manufacturers’ specifications. The primary antibodies were incubated at 4 ℃ for 18 h. The secondary antibodies (Biosharp, Anhui, China) were incubated at room temperature for 2 h. Protein bands were visualized by enhanced chemiluminescence (PE0010, Solarbio).
IF staining
The 786-O and Caki-1 cells were plated onto polylysine-coated coverslips and maintained at 37 ℃ for 24 h. Following fixation with 4% paraformaldehyde (PFA) at 4 ℃ for 40 min, the cells were permeabilized twice with 0.1% Triton X-100 (for 5 min each). Non-specific binding was blocked with 3% bovine serum albumin (BSA) in PBS at 37 ℃ for 1 h. After washing three times with PBS, the cells were exposed to anti-E-cadherin primary antibody (diluted in 3% BSA) overnight at 4 ℃. After washing three additional times with PBS, fluorescent-labeled secondary antibody (Abcam, Cambridge, UK) was applied for 1 h under light-protected conditions. 4',6-Diamidino-2-Phenylindole (DAPI; ID2250, Solarbio) counterstaining was then performed for 10 min in the dark, followed by mounting medium (Solarbio) application. Upon solidification, fluorescence microscopy was employed for visualization.
Transwell assays
For migration assessment, the cells were collected and resuspended in a basal medium at a density of 1×106 cells/mL. Aliquots (100 µL) were transferred into the upper chamber of the Transwell inserts (8 µm pore size; Corning, NY, USA), while complete medium (600 µL) was added to the lower chamber. After incubation at 37 ℃ for 48 h, non-migrated cells residing in the upper chamber were carefully removed. Cells that had migrated to the membrane were subsequently fixed with 4% PFA for 15 min, stained with 1% crystal violet for 10 min, and examined under a light microscope for quantification. For invasion assays, Matrigel (Cat. No. 356234, EMD Millipore, Billerica, MA, USA) was thawed overnight at 4 ℃ and subsequently diluted with ice-cold basal medium (1:3 v/v). A 40 µL volume of this mixture was layered onto the Transwell insert and allowed to polymerize at 37 ℃ for 2 h. All subsequent procedures were performed as described for the migration assay. Image acquisition and cell counting were performed by investigators blinded to group allocation.
Dual-luciferase reporter assay
Potential binding sites between XIST and miR-141-3p were predicted using RNA22 and TargetScanHuman 7.1. The 3'-untranslated regions (3'-UTRs) of XIST and ZEB1 were PCR-amplified, and wild-type (WT) constructs—including pmirGLO-XIST (5'-GCCTCTTTGCTGGGTAATGTTG-3'), ZEB1-WT1 (5'-CAAAATCATCAGAATCAGTGTTT-3'), ZEB1-WT2 (5'-TGAGATTTGATTTAACAGTGTTA-3'), and ZEB1-WT3 (5'-ATTAACTTCTATAAACAGTGTTG-3')—were synthesized by GenePharma Co., Ltd. (Shanghai, China). Corresponding mutant (Mut) variants—including XIST-Mut (5'-GCCTGTTCCTTGTGATGTTG-3'), ZEB1-mut1 (5'-CAAAATCATCAGAATTAGTCGTT-3'), ZEB1-mut2 (5'-TGAGATTTGATTTAAATTGTCGA-3'), and ZEB1-mut3 (5'-ATTAACTTCTATAAGGATTCTAG-3')—were generated via a site-directed mutagenesis kit.
For transfection, the 293T cells were dissociated with 0.25% trypsin, collected in PBS, and seeded at 4×104 cells/well into 24-well plates. After overnight incubation at 37 ℃ in 5% CO2, the co-transfection of the miR-141-3p mimics and recombinant plasmids was performed using Lipofectamine 3000 (Invitrogen) in accordance with the manufacturer’s instructions. Luciferase signals were quantified using the TransDetect® Double-Luciferase Reporter Assay Kit (Takara, Shiga, Japan), with firefly values normalized against Renilla activity.
Statistical analysis
All experiments were performed with at least three biological replicates (independent cell cultures). No data points were excluded from the analysis. The statistical analyses were performed using SPSS 23.0 (IBM Corp., Chicago, IL, USA). The results are expressed as mean ± standard deviation (SD). Differences between two groups were analyzed using an unpaired Student’s t-test; while comparisons among multiple groups were performed using one-way analysis of variance followed by Tukey’s post hoc test. A P value <0.05 was considered statistically significant.
Results
TGF-β induces EMT differentiation and upregulates XIST expression in RC cells
At day 0, the cells were polygonal, maintained tight intercellular connections, and demonstrated a clustered growth pattern. Referring to our previously published studies, 10 ng/mL TGFβ1 was used as the induction condition for EMT in 786-O and Caki-1 cells in the present research (35). Following TGF-β stimulation, the cells transitioned from an epithelioid carcinoma phenotype to a spindle-shaped morphology, accompanied by reduced intercellular adhesion and a scattered growth pattern. The proportion of EMT-differentiated cells increased in a time-dependent manner with prolonged TGF-β exposure (Figure 1A). Additionally, the RT-qPCR analysis revealed that XIST expression increased in a time-dependent manner following TGF-β exposure, with the most significant upregulation observed at day 21 (Figure 1B). These results indicate that TGF-β induces EMT and upregulates XIST expression in RC cells.
LncRNA XIST silencing inhibits proliferation, EMT, migration, and invasion, and induces apoptosis in TGF-β-mediated RC cells
Based on the above results, TGF-β treatment upregulated XIST expression in RC cells, suggesting its potential role in the TGF-β-induced progression of RC. After 21 days of exposure to 10 ng/mL TGF-β, the 786-O and Caki-1 cells were transfected with three distinct si-XIST constructs: si-XIST-1, si-XIST-2, and si-XIST-3. As shown in Figure 2A, XIST expression was significantly reduced in all si-XIST groups compared to the si-NC group, with the si-XIST-3-treated group exhibiting the strongest silencing effect. Therefore, si-XIST-3 was selected for subsequent experiments.
The microscopic results showed that the cells in the NC group maintained tight intercellular connections and a clustered growth pattern. Conversely, the TGF-β-exposed cells exhibited a fusiform morphology, accompanied by a loss of polarity and scattered proliferation. Notably, XIST knockdown, substantially decreased the percentage of EMT-differentiated cells (Figure 2B).
RT-qPCR analysis confirmed that XIST silencing significantly downregulated XIST expression, whereas TGF-β treatment upregulated XIST expression in both the 786-O and Caki-1 cells. Notably, XIST silencing counteracted the TGF-β-induced upregulation of XIST (Figure 2C). MTT assays showed that the TGF-β treatment enhanced cell proliferation, while XIST silencing inhibited the TGF-β-induced proliferation in the 786-O and Caki-1 cells (Figure 2D). Moreover, flow cytometry analysis revealed that XIST silencing significantly increased apoptosis in the TGF-β-treated RC cells (Figure 2E).
Additionally, western blot analysis showed TGF-β upregulated the expression of N-cadherin, Vimentin, and Snail, while XIST silencing reversed this effect (Figure 2F). The immunofluorescence (IF) staining results suggested that TGF-β treatment downregulated E-cadherin expression in RC cells, while XIST silencing restored its expression (Figure 2G), suggesting that XIST silencing inhibits TGF-β-induced EMT in RC cells. The Transwell assay further supported these findings, showing that TGF-β significantly enhanced cell migration and invasion compared to the NC group. However, XIST silencing attenuated TGF-β-induced migration and invasion in the RC cells (Figure 2H,2I).
Collectively, these results indicate that XIST silencing inhibits proliferation, EMT, migration, and invasion, while promoting apoptosis in TGF-β-treated 786-O and Caki-1 cells, suggesting that lncRNA XIST exerts oncogenic effects in RC progression.
XIST targets and negatively regulates miR-141-3p
As shown in Figure 3A, XIST harbors a putative binding site for miR-141-3p. To validate this interaction, XIST was silenced in the TGF-β-treated 786-O and Caki-1 cells. The RT-qPCR analysis demonstrated that XIST knockdown significantly upregulated miR-141-3p expression (Figure 3B). Further, dual-luciferase reporter assays revealed that ectopic miR-141-3p expression substantially reduced luciferase signals from the WT-XIST construct, while Mut-XIST activity remained unaffected (Figure 3C). Taken together, these results suggest that XIST directly targets miR-141-3p and negatively regulates its expression.
Inhibition of miR-141-3p attenuates the suppressive effects of lncRNA XIST silencing on proliferation, EMT, migration, and invasion, while promoting apoptosis in TGF-β-induced RC cells
Given the established regulatory relationship between XIST and miR-141-3p, their functional roles were further investigated in the TGF-β-stimulated RC cells. The si-XIST and miR-141-3p inhibitors were co-introduced into the 786-O and Caki-1 cells following TGF-β treatment. RT-qPCR analysis revealed that XIST knockdown increased miR-141-3p expression, while miR-141-3p suppression had no effect on XIST expression. Notably, inhibiting miR-141-3p reversed the upregulation of miR-141-3p induced by XIST silencing (Figure 4A).
Microscopic examinations revealed that XIST silencing substantially reduced the proportion of EMT-differentiated cells in the TGF-β-treated cultures; however, this effect was abolished upon co-transfection with the miR-141-3p inhibitor (Figure 4B). In addition, the MTT assays showed that lncRNA XIST silencing reduced proliferation in the TGF-β-treated 786-O and Caki-1 cells, while miR-141-3p inhibition reversed this effect (Figure 4C). Similarly, apoptosis induced by XIST silencing was reversed by miR-141-3p inhibition in the TGF-β-treated RC cells (Figure 4D).
Western blot analysis showed that XIST silencing reduced the expression of N-cadherin, Vimentin, and Snail in the TGF-β-treated RC cells. However, these effects were reversed by miR-141-3p inhibition (Figure 4E). The IF staining showed that XIST silencing increased E-cadherin expression in the TGF-β-treated RC cells; however, miR-141-3p inhibition significantly weakened this upregulation (Figure 4F). Further, the Transwell assays revealed that miR-141-3p suppression enhanced the migratory and invasive capacities of the TGF-β-exposed RC cells following XIST knockdown, while restoring the miR-141-3p levels reversed these effects (Figure 4G,4H).
These findings indicate that XIST silencing inhibits RC progression through miR-141-3p, suggesting that miR-141-3p plays an inhibitory role in RC.
miR-141-3p directly targets and regulates ZEB1
To identify downstream messenger RNA (mRNA) targets of miR-141-3p, a bioinformatic analysis using TargetScan Human 7.1 predicted three conserved binding sites within the 3'-UTR of ZEB1 mRNA (Figure 5A). The RC cells pretreated with TGF-β for 21 days were then transfected with either negative control (mimics NC) or miR-141-3p mimics for 48 h. Transfection with miR-141-3p mimics significantly upregulated miR-141-3p expression and reduced ZEB1 mRNA levels (Figure 5B). Western blot analysis confirmed a marked reduction in ZEB1 protein expression (Figure 5C). Luciferase activity was substantially reduced in the cells co-transfected with miR-141-3p mimics and the WT pmirGLO-ZEB1-3'-UTR reporter (Figure 5D). No significant changes were observed in the Mut constructs (pmirGLO-mut) or mimics NC (Figure 5D). These results demonstrate that miR-141-3p directly targets ZEB1 through its 3'-UTR binding sites.
ZEB1 overexpression reverses the inhibitory effects of miR-141-3p mimics on proliferation, EMT, migration, and invasion in TGFβ-induced RC cells, while attenuating apoptosis
Given the interaction between miR-141-3p and ZEB1, their roles in the TGF-β-induced RC cells were further explored. TGF-β-pretreated 786-O and Caki-1 cells were transfected with either miR-141-3p mimics or ZEB1 overexpression plasmid. The RT-qPCR results showed that miR-141-3p mimics downregulated ZEB1 expression in the TGF-β-treated RC cells, and this effect was partially rescued by ZEB1 overexpression (Figure 6A). Morphological observations indicated that miR-141-3p mimics significantly decreased the proportion of EMT-differentiated cells, while ZEB1 overexpression reversed this effect (Figure 6B). MTT assays demonstrated that miR-141-3p mimics reduced proliferation, which was counteracted by ZEB1 overexpression (Figure 6C). Similarly, apoptosis induced by miR-141-3p mimics was reversed by ZEB1 overexpression (Figure 6D). Western blot analysis showed that miR-141-3p mimics downregulated N-cadherin, Vimentin, and Snail expression, while ZEB1 overexpression reversed these effects (Figure 6E). The IF staining results indicated that the miR-141-3p mimics increased E-cadherin expression, which was reduced upon ZEB1 overexpression (Figure 6F). Further, the Transwell assays revealed that ZEB1 overexpression restored the migratory and invasive capacities of the TGF-β-treated RC cells suppressed by miR-141-3p mimics (Figure 6G,6H).
Discussion
RC has the highest mortality rate among urological malignancies, with tumor metastasis accounting for approximately one-third of RC-related deaths (35). A deeper understanding of the molecular pathways driving RC progression is thus essential for the identification of robust biomarkers and viable therapeutic targets (36). TGF-β is an important component of the tumor microenvironment and is secreted by various cell types (37). Notably, TGF-β is a factor that routinely induces EMT differentiation in tumor cells (18). Previous studies have also reported increased TGF-β expression across various malignancies, including renal carcinoma, where serum and urinary concentrations are inversely associated with patient outcomes (38,39). In the context of RC, TGF-β has been implicated in tumor metastasis, primarily through the induction of EMT (40).
EMT describes the phenotypic conversion of epithelial cells into mesenchymal derivatives under distinct physiological or pathological stimuli (41). This process is characterized by the loss of epithelial characteristics (e.g., E-cadherin loss) and the acquisition of mesenchymal properties (42). Previous research has linked EMT to both RC progression and distant metastasis (43). In the present study, TGF-β was used to induce EMT in RC cells, and TGF-β stimulation was found to significantly enhance RC progression, consistent with previous research (44).
LncRNAs exert pivotal effects in gene regulation through sophisticated molecular mechanisms attributable to their distinctive structural configurations and sequence specificity (45). These transcripts display functional versatility, including transcriptional interference, modulation of protein function, induction of chromatin remodeling, and modification of cellular or protein architecture (25,46). Moreover, emerging evidence has shown that lncRNAs regulate neoplastic cell proliferation, apoptosis, and invasion, and thus hold promise as biomarkers for evaluating tumor characteristics (47,48).
Among this class of molecules, lncRNA XIST originates from X-nonspecific transcription factors and has been linked to a variety of pathological conditions, including cancer (49,50). LncRNA XIST has been identified as an oncogene in colorectal carcinoma (51). The present study provided evidence that TGF-β markedly upregulated lncRNA XIST in RC cells. Functional analyses revealed that XIST silencing effectively attenuated the TGF-β-induced proliferation, EMT, migration, and invasion of RC cells, while simultaneously promoting apoptosis. These findings suggests that lncRNA XIST acts as an oncogene in TGF-β-induced RC cells. However, the molecular mechanisms underlying the inhibitory effects of XIST knockdown on RC advancement remain to be fully elucidated.
MiRNAs are short endogenous non-coding molecules that regulate gene expression by binding to the 3'-UTR of their target genes. These transcripts function as downstream effectors of lncRNAs, mediating the biological functions of their regulatory counterparts. Moreover, lncRNAs can modulate various cellular processes by binding to miRNAs (52). Previous research has shown that XIST regulates the proliferation and apoptosis of RC cells by inhibiting the miR302c/SDC1 axis (53), suggesting that XIST contributes to the malignant progression of RC by regulating miRNA expression. The present study showed that XIST targets miR-141-5p; however, it is unclear whether XIST regulates RC progression by targeting miR-141-3p.
Our results further revealed that XIST targets miR-141-3p, and its knockdown leads to the upregulation of miR-141-3p, suggesting that XIST may regulate RC progression through miR-141-3p. Our in vitro findings demonstrated that lncRNA XIST knockdown suppressed proliferation, EMT, and metastatic potential, while triggering programmed cell death in TGF-β-stimulated RC via miR-141-3p modulation. Notably, miR-141-3p itself represents an extensively characterized oncomiR, whose principal role involves inhibiting neoplastic cell expansion, mesenchymal transition, and systemic dissemination (54). This is consistent with our findings, which indicate that miR-141-3p acts as a tumor suppressor in RC.
ZEB1 is a transcription factor known to promote tumor progression (55). High ZEB1 expression has been reported in clear cell renal carcinoma tissues (56). Mechanistically, CSN5 has been shown to enhance ZEB1 expression by directly binding to and inhibiting its ubiquitination, thereby promoting metastasis and EMT activation in clear cell renal carcinoma (57). Consistently, the present study demonstrated that miR-141-3p mimics target and suppress ZEB1 expression. Further, the overexpression of ZEB1 attenuated the inhibitory effects of miR-141-3p mimics on proliferation, EMT, migration, and invasion, while decreasing apoptosis in TGF-β-induced RC cells.
It is important to acknowledge the limitations of our study. The role of the lncRNA XIST/miR-141-3p/ZEB1 axis in cancers other than RC and pancreatic cancer remains unclear, warranting further investigation. We will prospectively collect paired renal carcinoma and adjacent normal renal tissues, detect XIST/miR-141-3p/ZEB1 expression via RT-qPCR, perform statistical correlation analysis with clinicopathological parameters (tumor T stage, lymphatic/distant metastasis) and long-term survival data, to further confirm the clinical translational value of this molecular axis. We assessed cell proliferation using the CCK-8 assay and detected cell apoptosis via flow cytometry, yet we did not examine the core downstream proteins associated with proliferation (Ki-67, PCNA) and apoptosis (Caspase-3, Bax and Bcl-2). We will supplement the detection of downstream signaling proteins related to cell proliferation and apoptosis in our follow-up research. Additionally, our findings require validation through in vivo experiments to demonstrate that the XIST/miR-141-3p/ZEB1 axis facilitates the proliferation and metastasis of renal carcinoma. Normal renal tubular epithelial cells were not included as control groups in the present study. Future research should also include a wider range of EMT markers to strengthen the conclusions regarding EMT regulation. Additionally, other cellular processes, such as autophagy, need to be further explored. We intend to systematically address these limitations in future research.
The targeted therapy of miRNAs and lncRNAs represents a promising approach for cancer treatment (58,59). In this context, the lncRNA XIST/miR-141-3p/ZEB1 axis represents a promising avenue of RC research. In the next five years, RC research on the lncRNA XIST/miR-141-3p/ZEB1 axis should aim to elucidate its mechanisms, identify biomarkers, and explore therapeutic targets, ultimately contributing to more individualized treatment strategies. LncRNA XIST, miR-141-3p, and ZEB1 may serve as key factors in the diagnosis, prognostic assessment, and treatment of RC. Moreover, pathways involving the XIST/miR-141-3p/ZEB1 axis may represent promising therapeutic targets for many cancers.
Conclusions
This study demonstrated that silencing lncRNA XIST inhibits proliferation, EMT, and metastasis, while promoting apoptosis in TGF-β-treated RC cells by regulating the miR-141-3p/ZEB1 axis in vitro. Our findings provide a basis for the development of targeted therapies aimed at the lncRNA XIST/miR-141-3p/ZEB1 axis, offering a promising strategy for the effective treatment of RC.
Acknowledgments
None.
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tau.amegroups.com/article/view/10.21037/tau-2026-0536/rc
Data Sharing Statement: Available at https://tau.amegroups.com/article/view/10.21037/tau-2026-0536/dss
Peer Review File: Available at https://tau.amegroups.com/article/view/10.21037/tau-2026-0536/prf
Funding: This work was supported by
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tau.amegroups.com/article/view/10.21037/tau-2026-0536/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Yong C, Stewart GD, Frezza C. Oncometabolites in renal cancer. Nat Rev Nephrol 2020;16:156-72. [Crossref] [PubMed]
- Qureshi AS, Ali S. Review: Warburg effect and renal cancer caused by errs in fumarate hydratase encoding gene. Pak J Pharm Sci 2019;32:743-9.
- Lakovschek IC, Petru E, Pollheimer MJ, et al. A rare case of cancer-to-cancer metastasis: breast cancer to renal cell cancer : Case report and review of literature. Wien Med Wochenschr 2019;169:350-3. [Crossref] [PubMed]
- Rosiello G, Larcher A, Montorsi F, et al. Renal cancer: overdiagnosis and over-treatment. World J Urol 2021;39:2821-3. [Crossref] [PubMed]
- Usher-Smith J, Simmons RK, Rossi SH, et al. Current evidence on screening for renal cancer. Nat Rev Urol 2020;17:637-42. [Crossref] [PubMed]
- Rossi SH, Klatte T, Usher-Smith J, et al. Epidemiology and screening for renal cancer. World J Urol 2018;36:1341-53. [Crossref] [PubMed]
- Tan PH, Cheng L, Rioux-Leclercq N, et al. Renal tumors: diagnostic and prognostic biomarkers. Am J Surg Pathol 2013;37:1518-31. [Crossref] [PubMed]
- Gul A, Rini BI. Adjuvant therapy in renal cell carcinoma. Cancer 2019;125:2935-44. [Crossref] [PubMed]
- Gray RE, Harris GT. Renal Cell Carcinoma: Diagnosis and Management. Am Fam Physician 2019;99:179-84.
- Zhang Y, Zhang Z. The history and advances in cancer immunotherapy: understanding the characteristics of tumor-infiltrating immune cells and their therapeutic implications. Cell Mol Immunol 2020;17:807-21. [Crossref] [PubMed]
- Tan S, Li D, Zhu X. Cancer immunotherapy: Pros, cons and beyond. Biomed Pharmacother 2020;124:109821. [Crossref] [PubMed]
- Guven DC, Sahin TK, Erul E, et al. The association between albumin levels and survival in patients treated with immune checkpoint inhibitors: A systematic review and meta-analysis. Front Mol Biosci 2022;9:1039121. [Crossref] [PubMed]
- Lavacchi D, Pellegrini E, Palmieri VE, et al. Immune Checkpoint Inhibitors in the Treatment of Renal Cancer: Current State and Future Perspective. Int J Mol Sci 2020;21:4691. [Crossref] [PubMed]
- Parikh M, Bajwa P. Immune Checkpoint Inhibitors in the Treatment of Renal Cell Carcinoma. Semin Nephrol 2020;40:76-85. [Crossref] [PubMed]
- Rosellini M, Marchetti A, Mollica V, et al. Prognostic and predictive biomarkers for immunotherapy in advanced renal cell carcinoma. Nat Rev Urol 2023;20:133-57. [Crossref] [PubMed]
- Rizzo A, Mollica V, Tateo V, et al. Hypertransaminasemia in cancer patients receiving immunotherapy and immune-based combinations: the MOUSEION-05 study. Cancer Immunol Immunother 2023;72:1381-94. [Crossref] [PubMed]
- Itkin B, Breen A, Turyanska L, et al. New Treatments in Renal Cancer: The AhR Ligands. Int J Mol Sci 2020;21:3551. [Crossref] [PubMed]
- Luo W, Shi Q, Han M, et al. TGF-β-driven EMT in cancer progression and drug resistance. Cytokine Growth Factor Rev 2025;85:11-25. [Crossref] [PubMed]
- Larson C, Oronsky B, Carter CA, et al. TGF-beta: a master immune regulator. Expert Opin Ther Targets 2020;24:427-38. [Crossref] [PubMed]
- Mier JW. The tumor microenvironment in renal cell cancer. Curr Opin Oncol 2019;31:194-9. [Crossref] [PubMed]
- Dias V, Alves Â, Medeiros R, et al. Unveiling the TGF-β/Smad signaling in renal carcinoma progression: Prognostic and therapeutic insights. Biochim Biophys Acta Rev Cancer 2025;1880:189372. [Crossref] [PubMed]
- Karpiuk KR, Młynarczyk G, Matowicka-Karna J, et al. Emerging Biomarkers in Urological Cancers: Angiogenesis and Damage-Associated Molecular Pattern Signaling. Int J Mol Sci 2025;26:9130. [Crossref] [PubMed]
- Wang S, Tang L, Huang N, et al. The Roles of Long Noncoding RNA in Depression. Front Biosci (Landmark Ed) 2023;28:321. [Crossref] [PubMed]
- Zhong L, Li X, Wang Y, et al. Long Noncoding RNAs in Ovarian Cancer-Functions and Clinical Applications. Front Biosci (Landmark Ed) 2023;28:71. [Crossref] [PubMed]
- Wang W, Min L, Qiu X, et al. Biological Function of Long Non-coding RNA (LncRNA) Xist. Front Cell Dev Biol 2021;9:645647. [Crossref] [PubMed]
- Sharen G, Meng H, Zhang L, et al. LncRNA XIST enhances gastric cancer cell function by regulating STAT3/PD-L1 axis as a competing endogenous RNA for miR-124. Am J Cancer Res 2025;15:1597-613. [Crossref] [PubMed]
- Ma Y, Qian L, Wang D, et al. LncRNA XIST Promotes Proliferation, Migration and Invasion of Esophageal Squamous Cell Carcinoma Cells via Regulation of miR-186-5p/ZEB1. Anticancer Res 2025;45:897-908. [Crossref] [PubMed]
- Sun K, Jia Z, Duan R, et al. Long non-coding RNA XIST regulates miR-106b-5p/P21 axis to suppress tumor progression in renal cell carcinoma. Biochem Biophys Res Commun 2019;510:416-20. [Crossref] [PubMed]
- Liu Y, Zhang W, Jin L, et al. The Role of Long Noncoding RNAs in Endometriosis Progression. Front Biosci (Landmark Ed) 2023;28:109. [Crossref] [PubMed]
- Alkan AH, Cansaran-Duman D. Multifaceted interactions between lncRNA-associated ceRNA networks and small molecules in triple-negative breast cancer. Biomed Pharmacother 2025;189:118241. [Crossref] [PubMed]
- Cao M, Tian K, Sun W, et al. MicroRNA-141-3p inhibits the progression of oral squamous cell carcinoma via targeting PBX1 through the JAK2/STAT3 pathway. Exp Ther Med 2022;23:97. [Crossref] [PubMed]
- Liu Y, Fu W, Yin F, et al. miR-141-3p suppresses development of clear cell renal cell carcinoma by regulating NEK6. Anticancer Drugs 2022;33:e125-33. [Crossref] [PubMed]
- Tong SJ, Zhang XY, Guo HF, et al. Study on effects of miR-141-3p in proliferation, migration, invasion and apoptosis of colon cancer cells by inhibiting Bcl2. Clin Transl Oncol 2021;23:2526-35. [Crossref] [PubMed]
- Mo Y, Leung LL, Mak CSL, et al. Tumor-secreted exosomal miR-141 activates tumor-stroma interactions and controls premetastatic niche formation in ovarian cancer metastasis. Mol Cancer 2023;22:4. [Crossref] [PubMed]
- Hu X, Li D, Zhan J, et al. microRNA-141-3p Suppressed the Progression of the Clear Cell Renal Cell Carcinoma by Targeting Transforming Growth Factor Beta 2 Gene Expression. DNA Cell Biol 2024;43:245-57. [Crossref] [PubMed]
- Chakraborty S, Balan M, Sabarwal A, et al. Metabolic reprogramming in renal cancer: Events of a metabolic disease. Biochim Biophys Acta Rev Cancer 2021;1876:188559. [Crossref] [PubMed]
- Kim K, Zhou Q, Christie A, et al. Determinants of renal cell carcinoma invasion and metastatic competence. Nat Commun 2021;12:5760. [Crossref] [PubMed]
- Gough NR, Xiang X, Mishra L. TGF-β Signaling in Liver, Pancreas, and Gastrointestinal Diseases and Cancer. Gastroenterology 2021;161:434-452.e15. [Crossref] [PubMed]
- Bao JM, Dang Q, Lin CJ, et al. SPARC is a key mediator of TGF-β-induced renal cancer metastasis. J Cell Physiol 2021;236:1926-38. [Crossref] [PubMed]
- Nam H, Kundu A, Karki S, et al. The TGF-β/HDAC7 axis suppresses TCA cycle metabolism in renal cancer. JCI Insight 2021;6:e148438. [Crossref] [PubMed]
- Pallasch FB, Schumacher U. Angiotensin Inhibition, TGF-β and EMT in Cancer. Cancers (Basel) 2020;12:2785. [Crossref] [PubMed]
- Bakir B, Chiarella AM, Pitarresi JR, et al. EMT, MET, Plasticity, and Tumor Metastasis. Trends Cell Biol 2020;30:764-76. [Crossref] [PubMed]
- Shi S, Li Q, Cao Q, et al. EMT Transcription Factors Are Involved in the Altered Cell Adhesion under Simulated Microgravity Effect or Overloading by Regulation of E-cadherin. Int J Mol Sci 2020;21:1349. [Crossref] [PubMed]
- Sciacovelli M, Frezza C. Fumarate drives EMT in renal cancer. Cell Death Differ 2017;24:1-2. [Crossref] [PubMed]
- Hanusek K, Rybicka B, Popławski P, et al. TGF β1 affects the renal cancer miRNome and regulates tumor cells proliferation. Int J Mol Med 2022;49:52. [Crossref] [PubMed]
- Bhan A, Soleimani M, Mandal SS. Long Noncoding RNA and Cancer: A New Paradigm. Cancer Res 2017;77:3965-81. [Crossref] [PubMed]
- Eptaminitaki GC, Wolff N, Stellas D, et al. Long Non-Coding RNAs (lncRNAs) in Response and Resistance to Cancer Immunosurveillance and Immunotherapy. Cells 2021;10:3313. [Crossref] [PubMed]
- Park EG, Pyo SJ, Cui Y, et al. Tumor immune microenvironment lncRNAs. Brief Bioinform 2022;23:bbab504. [Crossref] [PubMed]
- Rathinasamy B, Velmurugan BK. Role of lncRNAs in the cancer development and progression and their regulation by various phytochemicals. Biomed Pharmacother 2018;102:242-8. [Crossref] [PubMed]
- Chen YK, Yen Y. The Ambivalent Role of lncRNA Xist in Carcinogenesis. Stem Cell Rev Rep 2019;15:314-23. [Crossref] [PubMed]
- Liu H, Wang D, Kan S, et al. The role of lncRNAs and XIST in oral cancer. Front Cell Dev Biol 2022;10:826650. [Crossref] [PubMed]
- Chen DL, Chen LZ, Lu YX, et al. Long noncoding RNA XIST expedites metastasis and modulates epithelial-mesenchymal transition in colorectal cancer. Cell Death Dis 2017;8:e3011. [Crossref] [PubMed]
- Li Y, Zhang J, Pan J, et al. Integrated bioinformatical analysis of lncRNA-mRNA co-expression profiles of cervical cancer. Clin Exp Obstet Gynecol 2021;48:1381-92.
- Zhang J, Cao Z, Ding X, et al. The lncRNA XIST regulates the tumorigenicity of renal cell carcinoma cells via the miR-302c/SDC1 axis. Int J Clin Exp Pathol 2017;10:7481-91.
- Liang Z, Li X, Liu S, et al. MiR-141-3p inhibits cell proliferation, migration and invasion by targeting TRAF5 in colorectal cancer. Biochem Biophys Res Commun 2019;514:699-705. [Crossref] [PubMed]
- Schwab A, Rao Z, Zhang J, et al. Zeb1 mediates EMT/plasticity-associated ferroptosis sensitivity in cancer cells by regulating lipogenic enzyme expression and phospholipid composition. Nat Cell Biol 2024;26:1470-81. [Crossref] [PubMed]
- Zhao J, Chen P, Tan C, et al. LncRNA LINC00667 gets involved in clear cell renal cell carcinoma development and chemoresistance by regulating the miR-143-3p/ZEB1 axis. Aging (Albany NY) 2023;15:10057-71. [Crossref] [PubMed]
- Zhang S, Hong Z, Chai Y, et al. CSN5 promotes renal cell carcinoma metastasis and EMT by inhibiting ZEB1 degradation. Biochem Biophys Res Commun 2017;488:101-8. [Crossref] [PubMed]
- Winkle M, El-Daly SM, Fabbri M, et al. Noncoding RNA therapeutics - challenges and potential solutions. Nat Rev Drug Discov 2021;20:629-51. [Crossref] [PubMed]
(English Language Editor: L. Huleatt)

