SESN2 promotes ferroptosis in bladder cancer by negatively regulating the NRF2/FSP1 signaling axis
Original Article

SESN2 promotes ferroptosis in bladder cancer by negatively regulating the NRF2/FSP1 signaling axis

Jianfeng Hu1, Yangmin Wang1, Yonghui Du2, Xi’an Li3, Zhiguo Zhang3, Xuehai Liang3, Junfeng Peng3

1Department of Urology, Xi’an Chang’an Hospital, Xi’an, China; 2Department of Urology, The Second Affiliated Hospital of Xi’an Medical University, Xi’an, China; 3Department of Urology, Xi’an Gemflower Changqing Hospital (Changqing Oilfield Workers’ Hospital), Xi’an, China

Contributions: (I) Conception and design: J Hu, J Peng; (II) Administrative support: J Peng; (III) Provision of study materials or patients: J Hu; (IV) Collection and assembly of data: J Hu, Y Wang, Y Du; (V) Data analysis and interpretation: X Li, Z Zhang, X Liang; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.

Correspondence to: Junfeng Peng, MB. Department of Urology, Xi’an Gemflower Changqing Hospital (Changqing Oilfield Workers’ Hospital), No. 528 Changqing West Road, Majiawan Jinghe Industrial Park, Gaoling District, Xi’an 710200, China. Email: pengjunfeng029@163.com.

Background: Bladder cancer (BLCA) shows intrinsic ferroptosis resistance. Sestrin2 (SESN2) regulates ferroptosis in other diseases, but its role in BLCA is unknown. In this study, we sought to determine whether SESN2 contributes to the intrinsic ferroptosis resistance of BLCA and to elucidate the underlying molecular mechanisms.

Methods: SESN2 expression was measured in BLCA tissues, RT4 cells, T24 cells, and normal controls by quantitative real-time polymerase chain reaction, western blot, and immunofluorescence. Ferroptosis markers [glutathione (GSH), malondialdehyde (MDA), and Fe2+] and nuclear factor erythroid 2-related factor 2 (NRF2)/ferroptosis suppressor protein 1 (FSP1) levels were assessed in tissues and cells. RT4 cells were transfected with SESN2 overexpression plasmid, and changes in GSH, MDA, and NRF2/FSP1 were examined. Inhibitors ML385 (NRF2) and iFSP1 (FSP1) were used to verify pathway involvement.

Results: SESN2 was downregulated in BLCA tissues and cells. BLCA displayed a ferroptosis-resistant phenotype (higher GSH, lower MDA and Fe2+) with elevated NRF2/FSP1 expression. SESN2 overexpression reduced GSH, increased MDA and Fe2+, and downregulated NRF2/FSP1 expression. Inhibitor treatment further lowered NRF2/FSP1 expression and partially reversed the changes in GSH, MDA, and Fe2+.

Conclusions: SESN2 is downregulated in BLCA and promotes ferroptosis by negatively regulating the NRF2/FSP1 axis. This study identifies a novel role of SESN2 in BLCA ferroptosis and suggests targeting this pathway as a potential therapeutic strategy.

Keywords: Bladder cancer (BLCA); Sestrin2 (SESN2); ferroptosis; nuclear factor erythroid 2-related factor 2/ferroptosis suppressor protein 1 axis (NRF2/FSP1 axis)


Submitted May 21, 2026. Accepted for publication Aug 05, 2026. Published online Aug 28, 2026.

doi: 10.21037/tau-2026-0472


Highlight box

Key findings

• Sestrin2 (SESN2) is significantly downregulated in bladder cancer (BLCA) tissues and cells.

• BLCA displays an intrinsic ferroptosis-resistant phenotype with elevated nuclear factor erythroid 2-related factor 2 (NRF2)/ferroptosis suppressor protein 1 (FSP1) expression.

• SESN2 overexpression reverses ferroptosis resistance by reducing glutathione (GSH) while increasing malondialdehyde (MDA) and Fe2+ levels.

• SESN2 promotes ferroptosis by negatively regulating the NRF2/FSP1 signaling axis.

What is known and what is new?

• BLCA exhibits intrinsic resistance to ferroptosis, limiting the efficacy of ferroptosis-based therapies. The NRF2/FSP1 axis is a well-established defensive pathway against ferroptosis. However, the role of SESN2 in BLCA ferroptosis remains unknown.

• This study identifies SESN2 as a novel promoter of ferroptosis in BLCA. It uncovers that SESN2 drives ferroptosis by negatively regulating the NRF2/FSP1 axis, thereby reversing ferroptosis resistance.

What is the implication, and what should change now?

• The SESN2/NRF2/FSP1 axis is a key regulator of ferroptosis susceptibility in BLCA. Downregulation of SESN2 contributes to ferroptosis resistance, while its restoration sensitizes BLCA cells to ferroptosis.

• The SESN2/NRF2/FSP1 pathway should be explored as a promising therapeutic target for BLCA. Future research should focus on developing pharmacological SESN2 activators or utilizing NRF2/FSP1 inhibitors to overcome ferroptosis resistance, and evaluating SESN2 as a potential predictive biomarker.


Introduction

As a malignancy of the urinary system, bladder cancer (BLCA) ranks as the tenth most common cancer worldwide, with approximately 573,000 new cases and 213,000 deaths annually (1-3). The onset of BLCA is closely associated with smoking, occupational exposure, and aging, with a markedly higher incidence in men—occurring three to four times more frequently than in women (2,4,5). Based on the depth of invasion, BLCA is classified into non-muscle-invasive bladder cancer (NMIBC) and muscle-invasive bladder cancer (MIBC) (6). Although treatments such as transurethral resection have improved outcomes for NMIBC, the five-year recurrence rate remains around 50%, with some patients progressing to MIBC (7,8). Platinum-based combination chemotherapy is the standard first-line treatment for MIBC and metastatic BLCA; however, its efficacy is limited by drug resistance and severe adverse effects. Only about 40% of patients with MIBC derive benefit, and the five-year survival rate for those with metastatic disease falls below 10% following chemotherapy (6,9). Therefore, a deeper understanding of the molecular mechanisms underlying BLCA is urgently needed to facilitate the development of novel therapeutic targets and improve patient outcomes.

In recent years, ferroptosis, a newly identified form of regulated cell death, has gained significant attention for its potential to overcome chemotherapy resistance and inhibit tumor growth (10,11). Distinct from apoptosis, ferroptosis is primarily characterized by iron-dependent accumulation of lipid peroxides, with its core mechanisms involving the inhibition of glutathione peroxidase 4 (GPX4) function and disruption of iron metabolism (12). Within the regulatory network of ferroptosis, ferroptosis suppressor protein 1 (FSP1) has been established as a key glutathione (GSH)-independent regulator that inhibits ferroptosis by reducing coenzyme Q10 to scavenge lipid radicals (13). Nuclear factor erythroid 2-related factor 2 (NRF2) is a critical transcription factor in cellular antioxidant defense, and activation of the NRF2 signaling pathway is considered a major defense mechanism against ferroptosis in cancer cells (14). Studies have shown that NRF2 transcriptionally regulates FSP1 expression and have revealed that the CoQ-FSP1 axis mediates ferroptosis resistance and radioresistance in KEAP1-deficient lung cancer cells (15). However, the role of the NRF2/FSP1 pathway in BLCA remains unexplored.

Sestrin2 (SESN2) is a stress-inducible protein, the expression of which is upregulated under conditions such as oxidative stress, nutrient deprivation, and DNA damage (16). Previous studies have shown that Sestrin2 inhibits ferroptosis following intestinal ischemia–reperfusion injury through the Keap1/Nrf2 signaling pathway (17). Liang et al. demonstrated that treatment with isothiocyanate (ISO) induces autophagy and suppresses BLCA growth by transcriptionally upregulating SESN2 expression in a MAPK8-JUN-dependent manner (18). Hua et al. reported that ChlA-F promotes both the transcription and messenger RNA (mRNA) stability of SESN2 via Sp1 and miR-27a, respectively, leading to marked upregulation of SESN2 protein levels and induction of autophagy, thereby inhibiting anchorage-independent growth of human BLCA cells (19). However, the role of SESN2 in regulating ferroptosis in BLCA has not yet been reported.

Therefore, this study was conducted to explore whether and how SESN2 regulates ferroptosis in BLCA. Clarifying this issue may reveal a novel mechanism of BLCA progression and offer new insights for therapeutic strategies targeting ferroptosis. We present this article in accordance with the MDAR reporting checklist (available at https://tau.amegroups.com/article/view/10.21037/tau-2026-0472/rc).


Methods

Tissue sample sources

Six pairs of BLCA and adjacent non-tumor tissue (paracancerous tissue) samples were obtained from male patients aged 55–65 years who underwent surgical resection at Xi’an Chang’an Hospital. The clinicopathological characteristics of the patients are listed in Table S1. Tissue samples were immediately frozen in liquid nitrogen after resection and stored at −80 ℃ until further use. This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Ethics Committee of Xi’an Chang’an Hospital (No. cayy2026-1). Written informed consent was obtained from each patient prior to tissue collection.

Cell culture and treatment

The SV-40 immortalized human uroepithelial cell line SV-HUC-1 (CL-0222; RRID: CVCL_3798) and the human BLCA cell lines RT4 (Cat# CL-0431; RRID: CVCL_0036) and T24 (Cat# CL-0227; RRID: CVCL_0554) were all purchased from Procell (Wuhan, China). SV-HUC-1 cells were cultured in Ham’s F-12K medium (Cat# 21127022, Gibco, USA), while RT4 and T24 cells were maintained in McCoy’s 5A medium (Cat# 16600082, Gibco). Both media were supplemented with 10% fetal bovine serum (FBS) (Cat# A5256701, Gibco), and all cells were incubated at 37 ℃ in a humidified atmosphere containing 5% CO2.

Cell transfection

RT4 cells were transfected with either an SESN2 overexpression plasmid (pcDNA3.1-SESN2) or an empty pcDNA3.1 vector [serving as a negative control (NC)] using Lipofectamine 3000 (Cat# L3000015, Invitrogen, USA). Prior to transfection, cells were serum-starved for 4 h. After 48 h of transfection, the cells were harvested for subsequent experiments.

Quantitative real-time polymerase chain reaction (qRT-PCR)

Total RNA was extracted from cells and tissues using TRIzolTM Reagent (Cat# 15596026, Thermo Fisher Scientific, USA). Reverse transcription of total RNA into complementary DNA (cDNA) was performed using the PrimeScriptTM RT Reagent Kit (Cat# RR037A, Takara, Japan). Following reverse transcription, qRT-PCR was carried out using the SYBR Premix Ex Taq Kit (Cat# DRR420A, Takara). GAPDH was used as the internal reference gene for qRT-PCR. Gene-specific primers were designed and displayed in Table 1. Amplification was performed using a real-time PCR system (CFX Connect, Bio-Rad, USA) with three technical replicates for each sample. Relative mRNA expression levels were quantified using the 2−ΔΔCt method.

Table 1

Gene-specific oligonucleotide primers designed for qRT-PCR

Gene name Gene ID Forward primer (5'–3') Reverse primer (5'–3')
SESN2 83667 AAGACCATGGCTACTCGCTG AGCTGGTTCACCTCCCCATA
NRF2 4780 TGGTTCCAAGTCCAGAAGCC CACTGTCAACTGGTTGGGGT
FSP1 84883 AATGAGGTTTCCAGCCAGCA GGCCACTTGGGAGTGAATGA
GAPDH 2597 GTCAAGGCTGAGAACGGGAA AAATGAGCCCCAGCCTTCTC

qRT-PCR, quantitative real-time polymerase chain reaction.

Western blot (WB) analysis

The cells were harvested and lysed with RIPA buffer (Cat# P0013K, Beyotime, Shanghai, China) for total protein extraction. Tissue samples were homogenized in ice-cold RIPA lysis buffer using a tissue grinder. The homogenates were lysed on ice for 30 min with occasional vortexing. After centrifugation at 12,000 ×g for 15 min at 4 ℃, the supernatants were collected. Protein quantification was performed using a bicinchoninic acid (BCA) assay kit (Cat# P0398S, Beyotime), after which samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The separated proteins were then electrotransferred onto a membrane. The membrane was subsequently blocked with 5% (w/v) skim milk for 1 h at room temperature. Following washing with Tris-buffered saline with Tween 20 (TBST), the membrane was incubated overnight at 4 ℃ with the following primary antibodies: SESN2 (Cat# ab178518, 1:5000, Abcam, UK), NRF2 (Cat# AF0639, 1:2,000, Affinity, USA), FSP1 (Cat# 68049-1-Ig, 1:5,000, Proteintech, USA), and GAPDH (Cat# AF7021, 1:10,000, Affinity). After removal of the primary antibodies and washing with TBST, the membrane was incubated with corresponding secondary antibodies: HRP-conjugated goat anti-mouse IgG (Cat# SA00001-1, 1:10,000, Proteintech) or horseradish peroxidase (HRP)-conjugated goat anti-rabbit immunoglobulin G (IgG) (Cat# RGAR001, 1:10,000, Proteintech) at room temperature for 1 h. Finally, after three additional TBST washes, protein bands were visualized using a chemiluminescence imaging system (Shanghai Tanon Science & Technology Co., Ltd., China; Tanon 5200) and quantified by grayscale analysis with ImageJ software (National Institutes of Health, USA; version 1.52).

Hematoxylin and eosin (H&E) staining

Tissue specimens were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned into 4-μm thick sections. Tissue sections were deparaffinized in xylene and rehydrated through graded ethanol series. Sections were stained with hematoxylin for 5 min, rinsed, differentiated in 1% hydrochloric acid-ethanol, and blued in Scott’s tap water. Following counterstaining with eosin for 2 min, sections were dehydrated, cleared in xylene, and mounted with neutral resin. Histopathological examination was conducted under a light microscope (Leica DM2500, Leica Microsystems, Germany).

Immunohistochemistry (IHC)

After deparaffinization and rehydration, 4-μm sections were subjected to microwave-assisted antigen retrieval in citrate buffer (pH 6.0). Endogenous peroxidase was blocked with 3% H2O2 for 15 min, followed by 5% bovine serum albumin (BSA) blocking for 1 h at room temperature. Sections were incubated overnight at 4 ℃ with anti-SESN2 primary antibody (Cat# ab244361, 1:100, Abcam). After phosphate-buffered saline (PBS) washes, sections were incubated with HRP-conjugated goat anti-rabbit IgG secondary antibody (Cat# ab205718, 1:2,000, Abcam) for 1 h at room temperature. Immunoreactivity was visualized with 3,3'-diaminobenzidine (DAB), followed by hematoxylin counterstaining. Sections were then dehydrated, cleared, and mounted for light microscopy.

Immunofluorescence (IF)

For cellular IF, cells were seeded on glass coverslips in 24-well plates and, upon reaching appropriate density, washed with PBS and fixed with 4% paraformaldehyde for 15 min at room temperature. For tissue IF, paraffin-embedded tissue sections were deparaffinized, rehydrated, and subjected to antigen retrieval in citrate buffer (pH 6.0) using a microwave. After cooling to room temperature, both cell and tissue samples were washed with PBS, permeabilized with 0.2% Triton X-100 for 10 min, and blocked with 5% BSA for 1 h. Subsequently, all samples were incubated with the following primary antibodies overnight at 4 ℃: SESN2 (Cat# ab244361, 1:200, Abcam), NRF2 (Cat# AF0639, 1:200, Affinity), and FSP1 (Cat# 68049-1-Ig, 1:400, Proteintech). After washing, the samples were then incubated with appropriate fluorophore-conjugated secondary antibodies for 1 h at room temperature in the dark. The coverslips or sections were mounted and then imaged using a fluorescence microscope (Olympus Corporation, Japan; DP73).

Detection of Fe2+, malondialdehyde (MDA), and GSH levels

The concentrations of Fe2+ (Cat# BC5415, Solarbio, Beijing, China), MDA (Cat# A003-1, Nanjing Jiancheng Bioengineering Institute, Nanjing, China), and GSH (Cat# A061-1, Nanjing Jiancheng Bioengineering Institute, China) were measured using commercial assay kits following the manufacturer’s protocols.

Statistical analysis

Statistical analyses were carried out with GraphPad Prism 10.2 (GraphPad Software, USA). All values are presented as the mean ± standard deviation from three biological replicates. An unpaired, two-tailed Student’s t-test was used to compare two groups, and one-way ANOVA with Tukey’s post hoc test was applied for comparisons of three or more groups. Statistical significance was set at P<0.05.


Results

SESN2 is downregulated in BLCA tissues and cell lines

To investigate the expression pattern of SESN2 in BLCA, we first examined clinical tissue specimens. H&E staining confirmed the typical histopathological features of paracancerous and BLCA tissues (Figure 1A). qRT-PCR and WB analyses demonstrated that both the mRNA and protein levels of SESN2 were significantly lower in BLCA tissues compared to paracancerous tissues (Figure 1B,1C). Subsequent IHC and IF analyses revealed substantial expression of SESN2 in paracancerous tissues, which was markedly depressed in BLCA tissues (Figure 1D,1E).

Figure 1 SESN2 is downregulated in bladder cancer tissues and cell lines. (A) Representative H&E staining images showing the histopathological morphology of paracancerous and BLCA tissues. Scale bar, 100 μm. (B) qRT-PCR analysis of SESN2 mRNA levels in paracancerous and BLCA tissue samples. (C) Western blot analysis and quantification of SESN2 protein expression in paracancerous and BLCA tissues. (D) Immunohistochemical staining of SESN2 in representative paracancerous and BLCA tissue sections. Scale bar, 100 μm. (E) Immunofluorescence staining of SESN2 in paracancerous and BLCA tissues. Nuclei were counterstained with DAPI. Scale bar, 100 μm. (F) qRT-PCR analysis of SESN2 mRNA levels in SV-HUC-1 and RT4 cells. (G) Western blot analysis and quantification of SESN2 protein expression in SV-HUC-1 and RT4 cells. (H) Immunofluorescence staining of SESN2 in SV-HUC-1 and RT4 cells. Nuclei were stained with DAPI. Scale bar, 100 μm. **, P<0.01; ***, P<0.001. BLCA, bladder cancer; DAPI, 4′,6-diamidino-2-phenylindole; H&E, hematoxylin and eosin; mRNA, messenger RNA; NC, negative control; qRT-PCR, quantitative real-time polymerase chain reaction; SESN2, Sestrin2.

To further validate these findings in vitro, we assessed SESN2 expression in SV-HUC-1, RT4, and T24 cell lines. In line with the in vivo tissue results, qRT-PCR and WB showed that SESN2 mRNA and protein levels were notably lower in RT4 cells than in SV-HUC-1 cells (Figure 1F,1G). Consistently, similar analyses revealed that SESN2 expression was also significantly downregulated in T24 cells compared to SV-HUC-1 cells (Figure S1A,S1B). Moreover, IF staining provided visual evidence of reduced SESN2 expression at the cellular level; both RT4 cells and T24 cells exhibited relatively weaker SESN2 fluorescence intensity compared to SV-HUC-1 cells (Figure 1H, Figure S1C). Given the consistency of the results across the two BLCA cell lines, we subsequently performed our experiments using one of them, RT4 cells.

BLCA exhibits enhanced NRF2/FSP1 signaling and a ferroptosis-resistant phenotype

Given the significant downregulation of SESN2 in BLCA, we next sought to determine whether this deficiency is associated with alterations in ferroptosis sensitivity. Biochemical assays revealed that BLCA tissues exhibited a significantly higher GSH content, but lower levels of MDA and Fe2+, compared to paracancerous tissues (Figure 2A-2C). This biochemical profile—characterized by increased antioxidant capacity and reduced lipid peroxidation—suggests an intrinsic resistance to ferroptosis in BLCA. To investigate the potential molecular mechanisms underlying this phenotype, we assessed the status of the NRF2/FSP1 signaling axis. Both WB and IF analyses indicated that the protein expression and fluorescence intensity of NRF2 and its downstream anti-ferroptotic effector FSP1 were elevated in BLCA tissues relative to paracancerous tissues (Figure 2D,2E).

Figure 2 Bladder cancer exhibits enhanced NRF2/FSP1 signaling and a ferroptosis-resistant phenotype. (A) GSH levels in paracancerous and BLCA tissue samples. (B) MDA levels in paracancerous and BLCA tissue samples. (C) Fe2+ levels in paracancerous and BLCA tissue samples. (D) Western blot analysis and quantification of NRF2 and FSP1 protein expression in paracancerous and BLCA tissues. (E) Immunofluorescence staining of NRF2 and FSP1 in paracancerous and BLCA tissue sections. Nuclei were counterstained with DAPI. Scale bar, 100 μm. (F) GSH levels in SV-HUC-1 and RT4 cells. (G) MDA levels in SV-HUC-1 and RT4 cells. (H) Fe2+ levels in SV-HUC-1 and RT4 cells. (I) Western blot analysis and quantification of NRF2 and FSP1 protein expression in SV-HUC-1 and RT4 cells. (J) Immunofluorescence staining of NRF2 and FSP1 in SV-HUC-1 and RT4 cells. Nuclei were stained with DAPI. Scale bar, 100 μm. **, P<0.01; ***, P<0.001. BLCA, bladder cancer; DAPI, 4′,6-diamidino-2-phenylindole; FSP1, ferroptosis suppressor protein 1; GSH, glutathione; MDA, malondialdehyde; NC, negative control; NRF2, nuclear factor erythroid 2-related factor 2; SESN2-OE, SESN2-overexpression.

To further examine these observations in vitro, we used the SV-HUC-1 and RT4 cell lines. Consistent with the in vivo findings, RT4 cells showed higher GSH concentrations but lower MDA accumulation and Fe2+ levels compared to SV-HUC-1 cells (Figure 2F-H). Similarly, WB and IF staining confirmed increased expression of NRF2 and FSP1 in RT4 cells (Figure 2I,2J). Taken together, these data suggest that downregulation of SESN2 in BLCA is accompanied by activation of the NRF2/FSP1 pathway and reduced ferroptosis.

Overexpression of SESN2 promotes ferroptosis and suppresses the NRF2/FSP1 pathway in BLCA cells

To investigate the functional role of SESN2 in BLCA, we established a SESN2-overexpressing (SESN2-OE) RT4 cell line. WB analysis first confirmed successful overexpression of SESN2 in the SESN2-OE group compared to the NC group (Figure 3A). We then assessed whether SESN2 elevation could alter cellular sensitivity to ferroptosis. Notably, SESN2 overexpression significantly reduced intracellular GSH content (Figure 3B). Conversely, the levels of MDA and Fe2+ were markedly increased in the SESN2-OE group (Figure 3C,3D). This shift in redox balance—characterized by GSH depletion, Fe2+ accumulation, and massive lipid peroxidation—indicates that SESN2 overexpression facilitates ferroptosis in RT4 cells.

Figure 3 Overexpression of SESN2 promotes ferroptosis and suppresses the NRF2/FSP1 pathway in BLCA cells. (A) Western blot analysis and quantification of SESN2 protein expression in RT4 cells transfected with NC or SESN2 overexpression plasmid (SESN2-OE). (B) GSH levels in NC and SESN2-OE RT4 cells. (C) MDA levels in NC and SESN2-OE RT4 cells. (D) Fe2+ levels in NC and SESN2-OE RT4 cells. (E) Western blot analysis and quantification of FSP1, NRF2, and SESN2 protein expression in NC and SESN2-OE RT4 cells. ***, P<0.001. BLCA, bladder cancer; FSP1, ferroptosis suppressor protein 1; GSH, glutathione; MDA, malondialdehyde; NC, negative control; NRF2, nuclear factor erythroid 2-related factor 2; SESN2, Sestrin2.

Given the role of the NRF2/FSP1 axis in defending against ferroptosis, we next evaluated its status following SESN2 upregulation. WB analysis revealed that the protein levels of both NRF2 and FSP1 were downregulated in SESN2-OE cells compared to NC cells (Figure 3E). Overall, these findings suggest that SESN2 overexpression inhibits the NRF2/FSP1 pathway and promotes ferroptosis in BLCA cells.

Inhibition of the NRF2/FSP1 axis alters the ferroptotic phenotype induced by SESN2 overexpression

To further validate the role of the NRF2/FSP1 axis in SESN2-mediated ferroptosis, we employed specific inhibitors ML385 (an NRF2 inhibitor) or iFSP1 (an FSP1 inhibitor). WB analysis showed that the protein levels of NRF2 and FSP1 were further reduced in the SESN2-OE + ML385 and SESN2-OE + iFSP1 groups compared to the SESN2-OE group (Figure 4A). IF staining confirmed the decreased expression of NRF2 and FSP1 in these treated cells (Figure 4B). Importantly, treatment with ML385 or iFSP1 in SESN2-OE cells resulted in significant changes in ferroptosis markers. As shown in Figure 4C-4E, ML385 treatment partially restored GSH levels and reduced the accumulation of MDA and Fe2+, while iFSP1 exhibited similar effects. Collectively, these findings demonstrate that the NRF2/FSP1 pathway plays a crucial role in regulating SESN2-induced ferroptosis in BLCA cells.

Figure 4 Inhibition of the NRF2/FSP1 axis alters the ferroptotic phenotype induced by SESN2 overexpression. (A) Western blot analysis and quantification of NRF2 and FSP1 protein expression in RT4 cells treated as indicated: NC, SESN2-OE, SESN2-OE + ML385 (NRF2 inhibitor), and SESN2-OE + iFSP1 (FSP1 inhibitor). (B) Immunofluorescence staining of NRF2 and FSP1 in NC, SESN2-OE, SESN2-OE + ML385, and SESN2-OE + iFSP1 cells. Nuclei were counterstained with DAPI. Scale bar, 100 μm. (C) GSH levels in the indicated groups. (D) MDA levels in the indicated groups. (E) Fe2+ levels in the indicated groups. ***, P<0.001 vs. NC; ##, P<0.01 vs. SESN2-OE; ###, P<0.001 vs. SESN2-OE. DAPI, 4′,6-diamidino-2-phenylindole; FSP1, ferroptosis suppressor protein 1; GSH, glutathione; MDA, malondialdehyde; NC, negative control; NRF2, nuclear factor erythroid 2-related factor 2; SESN2, Sestrin2; SESN2-OE, SESN2-overexpression.

Discussion

Despite the potential of inducing ferroptosis as an anti-tumor strategy, BLCA cells frequently exhibit intrinsic resistance to ferroptosis. In this study, we demonstrate that SESN2 acts as a promoter of ferroptosis in BLCA cells by negatively regulating the NRF2/FSP1 signaling axis.

As a stress-inducible protein, SESN2 acts as a tumor suppressor in several types of cancer. Downregulation of SENS2 is often linked to tumor progression in hepatocellular carcinoma (20), colorectal cancer (21), and prostate cancer (22). In the present study, we found that SESN2 levels were significantly lower in both clinical BLCA tissues and BLCA cell lines. This is consistent with the tissue results previously reported by Liang et al. (18). To our knowledge, this is the first study to confirm the downregulation of SESN2 in BLCA at both the tissue and cellular levels. These findings help to clarify the expression pattern of SESN2 in BLCA and provide a basis for further functional studies.

Our results show that both BLCA tissues and cells display a ferroptosis-resistant phenotype, which is consistent with previous findings (23,24). As a new form of regulated cell death, ferroptosis has become a potential treatment strategy for various cancers, including BLCA (10,25). A recent study by An et al. suggests that SESN2 may be a key protein linking ferroptosis and mitophagy in triple-negative breast cancer (26). In addition, SESN2 has been shown to suppress ferroptosis after intestinal ischemia-reperfusion injury (17). SESN2 is also linked to ferroptosis in polycystic ovary syndrome (27) and to cigarette smoke-induced hippocampal ferroptosis in chronic obstructive pulmonary disease (28). Our study is the first to show that overexpressing SESN2 promotes ferroptosis in BLCA cells.

Recent studies have shown that the NRF2/FSP1 pathway is involved in the regulation of ferroptosis. In models of osteoporosis (29), hepatotoxic injury (30), and sepsis-induced acute kidney injury (31), modulating this pathway suppresses ferroptosis. In cancer research, Wang et al. found that highly adhesive ovarian cancer cells activate the NRF2/FSP1 pathway through the junctional adhesion molecule JAM3, thereby resisting ferroptosis (32). In the present study, we observed that the NRF2/FSP1 pathway is upregulated in BLCA cells. Overexpression of SESN2 inhibits this pathway and subsequently promotes ferroptosis in BLCA cells. Notably, since FSP1 is a well-established transcriptional target of NRF2, the SESN2-mediated reduction of NRF2 naturally leads to the subsequent transcriptional suppression of the downstream FSP1. This indicates that SESN2, NRF2, and FSP1 operate in a coordinated cascade rather than as independent parallel pathways. These findings provide new experimental evidence for understanding the role of this pathway in BLCA. Clinically, targeting the NRF2/FSP1 axis may represent a promising strategy to overcome ferroptosis resistance in tumors. Pharmacological inhibitors of this pathway could potentially enhance the efficacy of conventional therapies in BLCA and other NRF2/FSP1-driven cancers. Given the critical role of the NRF2/FSP1 pathway in mediating therapeutic resistance, pharmacological inhibition of this axis holds promising clinical potential for overcoming drug resistance in tumors by selectively inducing ferroptosis. Furthermore, combining NRF2/FSP1 inhibitors with conventional chemotherapy or targeted therapy may provide a novel synergistic strategy for cancer treatment.

Using inhibitors of NRF2 and FSP1, we further confirmed that the NRF2/FSP1 axis is functionally required for SESN2-induced ferroptosis in BLCA cells. Blocking either NRF2 or FSP1 attenuated the ferroptotic response induced by SESN2 overexpression, supporting a causal link between SESN2 and this signaling axis. These findings support that SESN2 promotes ferroptosis through negative regulation of the NRF2/FSP1 pathway.

Future studies will be extended in the following directions. First, experiments assessing proliferation, invasion, and migration will be performed to systematically evaluate the impact of SESN2 on the malignant phenotype of BLCA cells, thereby determining whether SESN2 alters tumor biological behavior through the regulation of ferroptosis. Second, in addition to the existing GSH, MDA, and Fe2+ indicators, lipid reactive oxygen species levels and the expression changes of ferroptosis marker proteins will be further examined to more comprehensively elucidate the molecular mechanism by which SESN2 regulates ferroptosis. Furthermore, the association of SESN2 expression with tumor stage, grade, depth of invasion, and patient prognosis will be analyzed in clinical cohorts to assess its potential value as a prognostic marker. In addition, RNA sequencing combined with bioinformatics analysis will be utilized to mine the upstream regulatory genes and potential mechanisms regulating SESN2, followed by experimental validation to clarify the molecular basis of SESN2 regulation. At the molecular level, co-immunoprecipitation and protein half-life assays will be conducted to directly verify the interaction between SESN2 and NRF2 and the regulation of NRF2 protein stability, aiming to clarify the specific molecular basis of SESN2-mediated regulation. Finally, a nude mouse xenograft model will be established to observe, at the in vivo level, the effects of SESN2 on tumor growth, ferroptosis biochemical markers, and the NRF2/FSP1 signaling axis, thereby providing comprehensive in vivo evidence for the therapeutic potential of targeting SESN2.


Conclusions

In summary, the present study demonstrates that SESN2 is downregulated in BLCA and that its overexpression promotes ferroptosis through negative regulation of the NRF2/FSP1 signaling axis. To our knowledge, this is the first report establishing a functional link between SESN2 and the NRF2/FSP1 pathway in ferroptosis regulation in BLCA. These findings not only expand the understanding of the molecular mechanisms underlying ferroptosis resistance in BLCA but also suggest that targeting the SESN2/NRF2/FSP1 axis may represent a potential therapeutic strategy for this malignancy.


Acknowledgments

None.


Footnote

Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tau.amegroups.com/article/view/10.21037/tau-2026-0472/rc

Data Sharing Statement: Available at https://tau.amegroups.com/article/view/10.21037/tau-2026-0472/dss

Peer Review File: Available at https://tau.amegroups.com/article/view/10.21037/tau-2026-0472/prf

Funding: None.

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tau.amegroups.com/article/view/10.21037/tau-2026-0472/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Ethics Committee of Xi’an Chang’an Hospital (No. cayy2026-1). Written informed consent was obtained from each patient prior to tissue collection.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.


References

  1. Dyrskjøt L, Hansel DE, Efstathiou JA, et al. Bladder cancer. Nat Rev Dis Primers 2023;9:58. [Crossref] [PubMed]
  2. Jubber I, Ong S, Bukavina L, et al. Epidemiology of Bladder Cancer in 2023: A Systematic Review of Risk Factors. Eur Urol 2023;84:176-90. [Crossref] [PubMed]
  3. Siegel RL, Kratzer TB, Giaquinto AN, et al. Cancer statistics, 2025. CA Cancer J Clin 2025;75:10-45. [Crossref] [PubMed]
  4. Lopez-Beltran A, Cookson MS, Guercio BJ, et al. Advances in diagnosis and treatment of bladder cancer. BMJ 2024;384:e076743. [Crossref] [PubMed]
  5. Liu Z, Tan T, Li S, et al. Bioinformatics analysis and experimental approach identify BRD-family gene DSP as a diagnostic and prognostic indicator in bladder cancer. Transl Androl Urol 2026;15:124. [Crossref] [PubMed]
  6. Li Y, Liu Y, Xi J, et al. Super-selective bladder arterial chemotherapy for muscle invasive bladder cancer. Transl Androl Urol 2026;15:172. [Crossref] [PubMed]
  7. Jin YH, Zeng XT, Liu TZ, et al. Treatment and surveillance for non-muscle-invasive bladder cancer: a clinical practice guideline (2021 edition). Mil Med Res 2022;9:44. [Crossref] [PubMed]
  8. Ding Q, Zhu H, Fan B, et al. Chromosomal instability as a predictive biomarker for recurrence risk following transurethral resection of NMIBC. Front Oncol 2026;16:1752078. [Crossref] [PubMed]
  9. Alfred Witjes J, Max Bruins H, Carrión A, et al. European Association of Urology Guidelines on Muscle-invasive and Metastatic Bladder Cancer: Summary of the 2023 Guidelines. Eur Urol 2024;85:17-31. [Crossref] [PubMed]
  10. Zhou Q, Meng Y, Li D, et al. Ferroptosis in cancer: From molecular mechanisms to therapeutic strategies. Signal Transduct Target Ther 2024;9:55. [Crossref] [PubMed]
  11. Wang Y, Wu N, Zhang S. Ferroptosis-autophagy crosstalk in bladder cancer: mechanisms and therapeutic implications. Mol Cancer 2026;25:86. [Crossref] [PubMed]
  12. Dixon SJ, Olzmann JA. The cell biology of ferroptosis. Nat Rev Mol Cell Biol 2024;25:424-42. [Crossref] [PubMed]
  13. Li W, Liang L, Liu S, et al. FSP1: a key regulator of ferroptosis. Trends Mol Med 2023;29:753-64. [Crossref] [PubMed]
  14. Jiang X, Yu M, Wang WK, et al. The regulation and function of Nrf2 signaling in ferroptosis-activated cancer therapy. Acta Pharmacol Sin 2024;45:2229-40. [Crossref] [PubMed]
  15. Koppula P, Lei G, Zhang Y, et al. A targetable CoQ-FSP1 axis drives ferroptosis- and radiation-resistance in KEAP1 inactive lung cancers. Nat Commun 2022;13:2206. [Crossref] [PubMed]
  16. Wang B J, Wang S, Xiao M, et al. Regulatory mechanisms of Sesn2 and its role in multi-organ diseases. Pharmacol Res 2021;164:105331. [Crossref] [PubMed]
  17. Zhang LL, Ding K, Liao SS, et al. Sestrin2 reduces ferroptosis via the Keap1/Nrf2 signaling pathway after intestinal ischemia-reperfusion. Free Radic Biol Med 2024;214:115-28. [Crossref] [PubMed]
  18. Liang Y, Zhu J, Huang H, et al. SESN2/sestrin 2 induction-mediated autophagy and inhibitory effect of isorhapontigenin (ISO) on human bladder cancers. Autophagy 2016;12:1229-39. [Crossref] [PubMed]
  19. Hua X, Xu J, Deng X, et al. New compound ChlA-F induces autophagy-dependent anti-cancer effect via upregulating Sestrin-2 in human bladder cancer. Cancer Lett 2018;436:38-51. [Crossref] [PubMed]
  20. Lu C, Jiang Y, Xu W, et al. Sestrin2: multifaceted functions, molecular basis, and its implications in liver diseases. Cell Death Dis 2023;14:160. [Crossref] [PubMed]
  21. Seo K, Seo S, Ki SH, et al. Sestrin2 inhibits hypoxia-inducible factor-1α accumulation via AMPK-mediated prolyl hydroxylase regulation. Free Radic Biol Med 2016;101:511-23. [Crossref] [PubMed]
  22. Kim YJ, Lee HJ, Kim KH, et al. Sestrin2 Overexpression Inhibits Proliferation and Epithelial-Mesenchymal Transition and Induces Autophagy Through the AMPK/mTOR Signaling Pathway in Human Prostate Cancer Cells. Prostate Cancer 2025;2025:8842203. [Crossref] [PubMed]
  23. Liu T, Xu X, Li J, et al. ALOX5 deficiency contributes to bladder cancer progression by mediating ferroptosis escape. Cell Death Dis 2023;14:800. [Crossref] [PubMed]
  24. Shen L, Zhang J, Zheng Z, et al. PHGDH Inhibits Ferroptosis and Promotes Malignant Progression by Upregulating SLC7A11 in Bladder Cancer. Int J Biol Sci 2022;18:5459-74. [Crossref] [PubMed]
  25. Ru Q, Li Y, Chen L, et al. Iron homeostasis and ferroptosis in human diseases: mechanisms and therapeutic prospects. Signal Transduct Target Ther 2024;9:271. [Crossref] [PubMed]
  26. An J, Chen P, Han M, et al. Inhibitory effect of blestriarene C on triple-negative breast cancer: Inducing ferroptosis and mitophagy via SESN2/AKT/FOXO4 axis. Chin Med J (Engl) 2026;139:699-709. [Crossref] [PubMed]
  27. Li YY, Xu N, Gu XY, et al. SESN2 suppresses ferroptosis in polycystic ovary syndrome by maintaining PRDX6 K209 lactylation. Free Radic Biol Med 2026;251:75-90. [Crossref] [PubMed]
  28. Zhang DW, Yang MM, Zhou MX, et al. Sestrin2 alleviates cognitive impairment via inhibiting hippocampus ferroptosis in cigarette smoke-induced chronic obstructive pulmonary disease. Redox Biol 2025;85:103673. [Crossref] [PubMed]
  29. Zhang Z, Rong X, Ren Q, et al. Vitamin K2 Protects Against Glucocorticoid-Induced Osteoporosis by Activating the NRF2/FSP1 Pathway to Inhibit Osteoblast Ferroptosis. Drug Des Devel Ther 2025;19:11525-45. [Crossref] [PubMed]
  30. Zhou J, Li Y, Xi C, et al. Apigenin Alleviates Fumonisin B1-Induced Hepatotoxicity by Suppressing Ferroptosis through the Nrf2/FSP1 Pathway. J Agric Food Chem 2025;73:26999-7011. [Crossref] [PubMed]
  31. Zhang Y, Zeng Y, Huang M, et al. Andrographolide attenuates sepsis-induced acute kidney injury by inhibiting ferroptosis through the Nrf2/FSP1 pathway. Free Radic Res 2024;58:156-69. [Crossref] [PubMed]
  32. Wang N, Chen M, Wu M, et al. High-adhesion ovarian cancer cell resistance to ferroptosis: The activation of NRF2/FSP1 pathway by junctional adhesion molecule JAM3. Free Radic Biol Med 2025;228:1-13. [Crossref] [PubMed]
Cite this article as: Hu J, Wang Y, Du Y, Li X, Zhang Z, Liang X, Peng J. SESN2 promotes ferroptosis in bladder cancer by negatively regulating the NRF2/FSP1 signaling axis. Transl Androl Urol 2026;15(9):332. doi: 10.21037/tau-2026-0472

Download Citation