Aberrant methylation of mitochondrial genes as a link between oxidative phosphorylation dysregulation and the pathogenesis of hypospadias: a multiomics and clinical sample study
Original Article

Aberrant methylation of mitochondrial genes as a link between oxidative phosphorylation dysregulation and the pathogenesis of hypospadias: a multiomics and clinical sample study

Hongchao Yang1,2,3, Jian Wang1,2, Youtian Zhang1,2, Wei Wang4, Liqiong Guo5, Shuhao Shi5, Zhenhua Zhang2, Yong Guan2, Hualei Cui2

1Graduate School, Tianjin Medical University, Tianjin, China; 2Tianjin Children’s Hospital/Children’s Hospital, Tianjin University, Tianjin, China; 3Department of Pediatric Surgery, Qilu Hospital of Shandong University Dezhou Hospital (Dezhou People’s Hospital), Dezhou, China; 4Tianjin Children’s Hospital/Children’s Hospital, Tianjin University, Precision Medicine Center, Precision Medicine Laboratory, Tianjin, China; 5School of Disaster and Emergency Medicine, Tianjin University, Tianjin, China

Contributions: (I) Conception and design: Y Guan, L Guo, H Yang; (II) Administrative support: H Cui; (III) Provision of study materials or patients: H Cui, Y Guan, W Wang; (IV) Collection and assembly of data: H Yang, J Wang, Y Zhang, S Shi, Z Zhang; (V) Data analysis and interpretation: H Yang, J Wang; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.

Correspondence to: Hualei Cui, MD. Tianjin Children’s Hospital/Children’s Hospital, Tianjin University, No. 238 Longyan Road, Beichen District, Tianjin 300134, China. Email: chltxzz@sina.com.

Background: Hypospadias is among the most prevalent congenital malformations in male newborns. Despite its clinical significance, the molecular etiology of hypospadias has not extensively characterized. Although environmental exposures, epigenetic dysregulation, and mitochondrial dysfunction have been identified as potential contributing factors, the role of mitochondrial DNA (mtDNA) methylation in the pathogenesis of hypospadias has not been systematically examined. Therefore, this study aimed to investigate the potential involvement of mtDNA methylation in hypospadias and to explore its association with mitochondrial gene expression and oxidative phosphorylation-related pathways.

Methods: To investigate mtDNA-related epigenetic alterations in hypospadias, an integrated analysis of transcriptomic and methylomic data was conducted. Alongside control specimens, preputial tissue samples were obtained from patients diagnosed with distal, midshaft, and proximal hypospadias. RNA sequencing (RNA-seq) was performed to profile gene expression. Subsequent functional enrichment analyses were conducted to identify the key disturbed biological pathways. Additionally, mtDNA methylation patterns were examined via publicly available methylation datasets, and this was followed by targeted validation with bisulfite pyrosequencing in order to facilitate the quantification of site-specific methylation levels of the selected mitochondrial genes.

Results: RNA-seq identified 96 differentially expressed genes (DEGs), of which 87 were upregulated and 9 downregulated. Subsequent functional enrichment analysis indicated that oxidative phosphorylation (OXPHOS)- and reactive oxygen species (ROS)-related pathways were the most significantly affected biological processes. Further analysis of mitochondrial gene transcriptomes revealed broadly similar upregulation patterns across different hypospadias subtypes, with MT-CO1, MT-CO3, MT-RNR2, and MT-ND6 being identified as the commonly dysregulated genes. Methylation analysis of target genes revealed unique epigenetic features in hypospadias tissue: MT-CO1 and MT-RNR2 exhibited significant hypomethylation, MT-ND6 showed hypermethylation, and MT-CO3 demonstrated no significant methylation changes. Notably, this methylation pattern was not significantly different across clinical subtypes, suggesting that it may represent a potentially shared epigenetic feature independent of anatomical classification.

Conclusions: Our findings indicate that aberrant mtDNA methylation is associated with altered mitochondrial gene expression and disrupted OXPHOS in hypospadias. This type of epigenetic dysregulation may impair mitochondrial energy metabolism and redox balance, thereby contributing to abnormal urethral development. These results constitute novel evidence linking mitochondrial epigenetic modifications to the pathogenesis of hypospadias and highlights potential of molecular targets in future risk assessment, early diagnosis, and preventive interventions.

Keywords: Hypospadias; mitochondrial DNA methylation (mtDNA methylation); oxidative phosphorylation (OXPHOS); multiple transcriptomic profiling; mitochondrial dysfunction


Submitted Mar 14, 2026. Accepted for publication Apr 07, 2026. Published online Apr 22, 2026.

doi: 10.21037/tau-2026-0251


Highlight box

Key findings

• RNA sequencing identified 96 differentially expressed genes (primarily upregulated genes), with the most significant effects observed in pathways related to oxidative phosphorylation (OXPHOS) and reactive oxygen species production.

• Key mitochondrial genes (MT-CO1, MT-CO3, MT-RNR2, and MT-ND6) exhibited consistent upregulation across distal, midshaft, and proximal hypospadias.

• Mitochondrial DNA (mtDNA) methylation analysis revealed a distinct epigenetic signature in hypospadias tissues, characterized by hypomethylation of MT-CO1 and MT-RNR2 and hypermethylation of MT-ND6, which appeared to be consistent across anatomical subtypes.

What is known and what is new?

• Hypospadias is a common congenital anomaly with a multifactorial etiology involving environmental exposures, hormonal imbalance, and epigenetic regulation. Furthermore, research indicates that mitochondrial dysfunction and oxidative stress are closely associated with the occurrence of hypospadias.

• This study generated the first systematic evidence that mtDNA methylation alterations are associated with hypospadias and identified an association of methylation changes in certain mitochondrial genes (MT-CO1, MT-RNR2, and MT-ND6) with abnormal mitochondrial gene expression and disrupted OXPHOS.

What is the implication, and what should change now?

• The findings suggest that aberrant mtDNA methylation may be involved in the pathogenesis of hypospadias, affecting mitochondrial energy metabolism and cellular redox balance during urethral development.

• The identified methylation markers (e.g., in MT-CO1, MT-RNR2, and MT-ND6) should be validated in larger cohorts as potential biomarkers for risk assessment. Future research should focus on clarifying the causal role of these epigenetic changes and examining preventive strategies targeting mitochondrial epigenetic homeostasis.


Introduction

Hypospadias, one of the most common congenital urogenital malformations in males, is characterized by an abnormal urethral meatus positioned on the ventral aspect of the penis, rather than at the tip of the glans penis. It is frequently accompanied by classic dorsal hooding of the prepuce and ventral preputial deficiency, with severe cases exhibiting varying degrees of penile curvature (chordee) (1). Epidemiological data indicate a rising global incidence of hypospadias, estimated at approximately 20.9 cases per 10,000 live births (2). Although its precise developmental origins remain incompletely understood, the etiology is widely regarded as multifactorial, involving a complex interplay of genetic susceptibility, disruptions in intrauterine hormonal milieu, and environmental influences (3,4). Furthermore, epidemiological studies have demonstrated notable familial clustering and hereditary predisposition for hypospadias (5,6). However, genetic screening of affected individuals has revealed that only a minority of cases can be attributed to the monogenic or chromosomal abnormalities associated with the condition (7,8), suggesting that other genetic mechanisms may play a key regulatory role. Recent studies have identified differentially methylated cytosine-phosphate-guanine (CpG) sites in the foreskin tissues of patients with hypospadias, suggesting the involvement of genetic dysregulation in pathways related to androgen metabolism (e.g., CYP4 family) and β-catenin signaling (e.g., PKP2 and TNKS) (9-11). These findings highlight the possibility of epigenetic mechanisms—specifically, the regulation of gene expression that does not alter the DNA sequence—as being a critical mediator in the pathogenesis of hypospadias. Exposure to environmental endocrine-disrupting chemicals (EDCs) has also been linked to hypospadias and is often accompanied by specific alterations in epigenetic markers such as DNA methylation (12,13). Thus, DNA methylation may be a functional link between genetic and environmental influences on human disease, modulating the expression of development-related genes and contributing to disease onset.

In mammalian genomes, DNA methylation, as an important epigenetic mechanism, involves a covalent modification in which a methyl group is added to the fifth carbon atom of cytosine bases in DNA under the catalysis of DNA methyltransferases (DNMTs) (14); this modification can alter chromatin conformation, affect the binding of transcription factors to DNA, and enable the precise regulation of gene expression, with hypermethylation frequently being associated with gene silencing (15). During embryonic development, precisely spatiotemporally controlled reprogramming of DNA methylation patterns is essential for cell fate determination, tissue differentiation, and organ formation, and its dysregulation may constitute the basis of developmental disorders (16). The formation of the urogenital system is particularly dependent on a stringent epigenetic regulatory network. Specifically, male genital development involves key stages such as genital ridge differentiation, urethral fold fusion, and urethral meatus positioning, during which precise expression of androgen signaling, β-catenin signaling, and germ layer differentiation-related genes is essential (17). One study demonstrated that in the foreskin tissues of patients with hypospadias, the androgen receptor (AR) gene exhibits aberrant hypermethylation accompanied by upregulated DNMT3A expression, which directly results in reduced AR expression and impaired androgen responsiveness of target tissues, potentially disrupting normal urethral fusion (18). Furthermore, genes such as estrogen receptor alpha (ESR1) and fibroblast growth factor receptor 2 (FGFR2) also exhibit significant alterations in DNA methylation and aberrant expression (9).

Of note, emerging evidence indicates that regulation of SRD5A2 expression by DNMT1 markedly influences mitochondrial stability and energy metabolism in the primary urethral epithelial cells associated with hypospadias (19). Male reproductive toxicity due to environmental endocrine disruptors, such as polybrominated diphenyl ethers, is also thought to involve interference with androgen signaling and disruption of mitochondrial function (20,21). Several studies have concluded that mitochondria, serving as the primary sites of energy production and major sources of reactive oxygen species (ROS), can disrupt the energy-demanding process of urethral development through altered energy metabolism and oxidative stress when dysfunctional (22-24). Although direct evidence linking mitochondrial DNA (mtDNA) methylation to hypospadias is lacking, these aforementioned studies have established mitochondrial dysfunction, epigenetic regulation, and environmental exposure as key contributors to hypospadias, thereby offering strong theoretical support for investigating mtDNA methylation as an integrative focal point in the present study.

Considering the above-described context, we conducted a study integrating transcriptomics and methylomics data to examine the aberrant DNA methylation characteristics of mitochondrial energy metabolism-related genes in hypospadias. Preputial tissues were collected from male patients with distal, midshaft, and proximal hypospadias and compared with those from control individuals. We first assessed the changes in the expression of relevant genes using high-throughput RNA sequencing (RNA-seq) and applied multiomics bioinformatic analyses to identify key mitochondrial genes. Subsequently, public and targeted gene DNA methylation data were used to characterize the methylation patterns of candidate genes in hypospadias. The aim of this work was to clarify the role of mitochondrial gene methylation dysregulation in the pathogenesis of hypospadias and generate novel insights at the molecular level regarding the etiology and preventive strategies of this congenital malformation. We present this article in accordance with the MDAR reporting checklist (available at https://tau.amegroups.com/article/view/10.21037/tau-2026-0251/rc).


Methods

Specimen source and collection

The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Ethics Committee of Tianjin Children’s Hospital (approval No. 2022-SYYJCYJ-006) and informed consent was taken from patients’ parents or legal guardians. Preputial tissues from the experimental group were obtained from 41 boys with hypospadias who were treated at Tianjin Children’s Hospital between September 2022 and September 2023. All patients underwent primary surgical repair. Only patients without chromosomal abnormalities, cryptorchidism, disorders of sex development (DSD), and other common congenital anomalies of the urogenital system were included. Among the enrolled patients, 32 preputial samples were subjected to mtDNA methylation analysis via pyrosequencing, while 9 samples were subjected to high-throughput RNA-seq. Hypospadias cases were classified by experienced pediatric urologists according to standardized medical and surgical coding criteria into distal hypospadias (meatal opening located between the glans and coronal sulcus), midshaft hypospadias (meatal opening located along the penile shaft), and proximal hypospadias (meatal opening located in the scrotal or perineal region). The cohort included 11 (26.8%) distal cases, 15 (36.6%) midshaft cases, and 15 (36.6%) proximal cases. Meanwhile, the control group consisted of 33 boys undergoing routine circumcision for phimosis, among whom 30 samples were used for mtDNA methylation analysis and 3 samples for RNA-seq analysis. The detailed demographic information, including age and sex of all participants, is provided in available online: https://cdn.amegroups.cn/static/public/tau-2026-0251-1.xlsx.

A total of 74 fresh preputial tissue samples excised during surgery were collected for analysis. All samples were thoroughly rinsed with sterile normal saline to remove residual blood, rapidly frozen in liquid nitrogen, and stored at −80 ℃ until further use. Sample collection and processing did not interfere with surgical outcomes.

RNA-seq and data analysis

Foreskin tissue samples were collected from pediatric patients with phimosis and hypospadias for transcriptome sequencing. Total RNA was extracted from the samples via TRIzol reagent, and the extracted RNA was subsequently sent to Novogene Co., Ltd. (Beijing, China) for RNA-seq analysis. R software version 4.2.1 (The R Foundation for Statistical Computing, Vienna, Austria) served as the primary data analysis tool in this study. Differential expression analysis between groups—with three biological replicates set for each experimental condition—was performed via the DESeq2 package (version 1.20.0) in R. Genes with an absolute fold change ≥1.5 and an adjusted P value (padj) <0.05 were identified as differentially expressed genes (DEGs). Gene Ontology (GO) enrichment analysis, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, and gene set enrichment analysis (GSEA) were all implemented with the clusterProfiler package (version 4.6.0) in R. For these analyses, statistical significance was defined as a padj <0.05 or a false discovery rate (FDR) q value <0.25. Multiple testing correction was performed with the Benjamini-Hochberg method to control the FDR.

Bioinformatics analysis

The microarray dataset GSE200681 was obtained from the GEO database. Differential expression analysis was performed with the DESeq2 R package (version 1.20.0). Enrichment analysis was implemented as described above.

mtDNA methylation analyses

For mtDNA methylation analyses, 200 mg of each sample was thawed at 4 ℃. The samples were treated with deoxyribonuclease I (DNase I) to eliminate cell-free DNA, which acts as the endogenous source of nuclear mitochondrial DNAs (NUMTs). mtDNA was isolated and subjected to bisulfite conversion through use of the EZ DNA Methylation Direct Kit (Zymo Research Corp., Irvine, CA, USA) in strict adherence with the manufacturer’s standard operating protocol. For mtDNA linearization, the purified mtDNA was enzymatically digested with the restriction endonuclease BamHI, and the methylation level of mtDNA was quantified via the polymerase chain reaction-pyrosequencing assay. Bisulfite-converted mtDNA (20 µL) was aliquoted and stored at −80 ℃ pending subsequent experimental analysis. The detailed nucleotide sequences of the primers are presented in Table 1. Ultimately, pyrosequencing of the preselected target genes was implemented on the Pyromark Q96 MD Pyrosequencing System (Qiagen, Hilden, Germany), with all subsequent data analysis being performed with Pyromark CpG software.

Table 1

Pyrosequencing primer sequence

Gene name Primer Sequence
MT-CO1 Forward primer (5'-3') TATTAATTGGTTTTTTAGGGTTTAT
Reverse biotin primer (5'-3') CAACAAATCATTTCATATTACTTCC
Sequencing primer (5'-3') TATTTATAGTAGGAAT
MT-CO3 Forward primer (5'-3') TATATTATTTGTTTAAAAAGGTTTT
Reverse biotin primer (5'-3') AATAAAAAACTCAAAAAAATCCTAC
Sequencing primer (5'-3') TATATTATTTGTTTAAAAAGGTTTT
MT-RNR2 Forward primer (5'-3') TGGTGTAGTAGTTATTAAAGGTT
Reverse biotin primer (5'-3') TCTCTTATCCTTTCCTACAAAAAAAAATTT
Sequencing primer (5'-3') AAAGTTTTAAGTGATTTGAGTTTAG
MT-ND6 Forward primer (5'-3') TTATTTATGGGGGTTTAGTATTGATTGT
Reverse biotin primer (5'-3') CCTCCCCCAAAATTCAAAATAATAACAC
Sequencing primer (5'-3') GGGGTTTAGTATTGATTGTT

Statistics analysis

Data are presented as the median and interquartile range (IQR). Statistical analyses were performed with GraphPad Prism 9.0 (Dotmatics, Boston, MA, USA). Bioinformatics data were processed and analyzed using R version 4.2.1 in RStudio (Posit PBC, Boston, MA, USA). Comparisons between groups were performed with the Fisher exact test, Mann-Whitney U test, or one-way analysis of variance (ANOVA), as appropriate. A P value <0.05 was considered statistically significant. At least three biological replicates were used for each analysis.


Results

Clinical data of pediatric patients

A total of 33 boys with phimosis and 41 boys with hypospadias were included in this study, and foreskin tissues were collected from all participants. Hypospadias cases were classified by pediatric urologists according to standard medical and surgical coding criteria, with 11 (26.8%) cases of distal hypospadias, 15 (36.6%) cases of midshaft hypospadias, and 15 (36.6%) cases of proximal hypospadias being identified. Because the age data in both groups were not normally distributed (hypospadias group: W=0.6023 and P<0.001; control group: W=0.8946 and P=0.004), age is presented as the median with the IQR. Specifically, the median age of patients in the hypospadias group (n=41) was 1.0 year, with a 25th percentile (P25) of 1.0 and a 75th percentile (P75) of 1.0 year (IQR, 1.0–1.0 year). In the control group (n=33), the median age was 4.0 years, with a P25 of 3.5 and a P75 of 4.0 years (IQR, 3.5–6.0 years). The age distribution differed significantly between the two groups, which is consistent with clinical practice. Hypospadias is typically diagnosed at birth and surgically corrected at an early age, whereas surgical intervention for phimosis is usually performed at a later age.

Further analysis revealed that the proportions of preterm birth and low birth weight were significantly higher in the hypospadias group than in the control group (P<0.05). In addition, a paternal family history of hypospadias was identified as a potential risk factor for the disease (P<0.05) (Table 2).

Table 2

Comparison of characteristics between the control group and the hypospadias group

Clinical feature Control group (n=33) Hypospadias group (n=41) P value
Case age (years) 4.0 (3.5–6.0) 1.0 (1.0–1.0) <0.001
Preterm birth 0 7 0.01
Low birth weight 1 9 0.04
Family history of hypospadias 0 6 0.03

Data are presented as median (25th percentile–75th percentile) or count (n).

Transcriptomic profiling revealed subtype-consistent mitochondrial dysregulation in hypospadias

To clarify the molecular mechanisms underlying hypospadias, foreskin tissues from 3 controls and 9 patients with hypospadias—including 3 distal, 3 midshaft, and 3 proximal cases—were subjected to high-throughput RNA-seq. Differential gene expression between the hypospadias and control groups was analyzed via the DESeq2 R package, with significance thresholds defined as padj <0.1 and |log2 fold change| >0.585. The distribution of DEGs is illustrated by the volcano plot in Figure 1A and the heatmap in Figure 1B. A total of 96 DEGs were identified between hypospadias samples and controls, including 87 upregulated and 9 downregulated genes. GO enrichment analysis indicated that these DEGs were predominantly associated with mitochondrial electron transport chain activity and energy metabolism-related biological processes, such as the aerobic electron transport chain and adenosine triphosphate (ATP) synthesis-coupled electron transport (Figure 1C). In line with this KEGG pathway analysis identified oxidative phosphorylation (OXPHOS) and ROS generation as the most significantly enriched pathways (Figure 1D). Furthermore, GSEA demonstrated significant positive enrichment of pathways related to OXPHOS and ATP synthesis-coupled electron transport in hypospadias samples (Figure 1E,1F). These findings led us to speculate that the aberrant expression of energy metabolism-related genes in mitochondria may contribute to the development of hypospadias.

Figure 1 Bioinformatics analysis of hypospadias foreskin samples. (A) DEGs between the control group and hypospadias group. (B) Heatmap of DEGs between the control group and the hypospadias group. (C) Top 15 enriched GO terms of the DEGs. (D) Top 15 enriched KEGG pathways. (E) GSEA indicated enhancement of the oxidative phosphorylation pathway. (F) GSEA indicated enhancement of the ATP synthesis-coupled electron transport. ATP, adenosine triphosphate; BP, biological process; CC, cellular component; DEG, differentially expressed gene; FDR, false discovery rate; GO, Gene Ontology; GSEA, gene set enrichment analysis; KEGG, Kyoto Encyclopedia of Genes and Genomes; MF, molecular function; NES, normalized enrichment score.

Subsequently, to further characterize mitochondrial gene dysregulation across different clinical subtypes of hypospadias, DEGs were compared between distal, midshaft, and proximal hypospadias samples. This analysis identified 10 core mitochondrial DEGs exhibiting a consistent expression pattern across all three subtypes (Figure 2A). Notably, MT-CO1, MT-CO3, MT-RNR2, and MT-ND6 were present in the intersection of subtype-specific DEG sets (Figure 2B), suggesting their roles as key mitochondrial regulators involved in the shared pathogenic mechanisms of hypospadias.

Figure 2 Expression of mitochondrial genes in different subtypes of hypospadias. (A) Heatmap of expression for 10 major mitochondrial genes. (B) Overlap analysis of mitochondrial DEGs in the different subtypes of hypospadias. DEG, differentially expressed gene.

Analysis of mitochondrial gene methylation patterns in hypospadias

The public dataset was incorporated into this study for further analysis and validation of the findings. This dataset was derived from a published study investigating DNA methylation profiles in foreskin tissues from boys with varying severities of hypospadias (11). Specifically, GSE200681 includes data from 17 mild, 13 moderate, and 6 severe hypospadias cases, along with foreskin tissues from 15 males who underwent routine circumcision as controls. Using methylated DNA immunoprecipitation (MeDIP), the original study assessed DNA fragment methylation levels; however, this method does not provide single-base resolution. Therefore, the methylation matrix deposited in GEO represents methylation signals across 1,000-bp DNA fragments.

Subsequently, we extracted methylation data for mtDNA fragments and screened target regions with P<0.05 (see available online: https://cdn.amegroups.cn/static/public/tau-2026-0251-2.xlsx for details). Based on MITOMAP annotation, the four target genes (MT-CO1, MT-CO3, MT-RNR2, and MT-ND6) corresponded to the genomic regions 5904–7445, 9207–9990, 1671–3229, and 14149–14673, respectively (Table 3). The reads per kilobase per million mapped reads (RPKM) values of mtDNA sequences covering these gene regions were used as a surrogate measure of their methylation levels. Notably, the RPKM values for these sequences were significantly lower in the mild hypospadias group, suggesting a tendency toward hypomethylation in mtDNA regions containing the target genes in boys with mild hypospadias (Figure 3). Collectively, these results constitute preliminary evidence indicating that aberrant methylation regulation of MT-CO1, MT-CO3, MT-RNR2, and MT-ND6—core genes involved in mitochondrial energy metabolism—may be associated with the pathogenesis of hypospadias.

Table 3

Mitochondrial gene annotation

Ensembl gene ID Symbol Start position End position Description
ENSG00000210082 MT-RNR2 1671 3229 16S ribosomal RNA
ENSG00000198804 MT-CO1 5904 7445 Cytochrome c oxidase subunit I
ENSG00000198938 MT-CO3 9207 9990 Cytochrome c oxidase subunit III
ENSG00000198695 MT-ND6 14149 14673 NADH dehydrogenase subunit 6
Figure 3 Methylation levels of mitochondrial gene regions in foreskin tissue derived from the public dataset GSE200681. Methylation levels were estimated based on MeDIP signals across genomic regions corresponding to the indicated mitochondrial genes. MeDIP, methylated DNA immunoprecipitation. **, P<0.01; ***, P<0.001.

Target mtDNA methylation levels

Targeted pyrosequencing was performed to quantitatively assess mtDNA methylation levels of the candidate mitochondrial genes in preputial tissues from the control and hypospadias groups. As summarized in the box plots in Figure 3, differential methylation levels were observed for MT-CO1, MT-CO3, MT-RNR2, and MT-ND6. Notably, these genes exhibited distinct methylation alteration patterns, which were consistent with the dysregulation of mitochondrial energy metabolism-related pathways indicated by our prior transcriptomic analysis.

Among the genes encoding the core catalytic subunits of mitochondrial respiratory chain complex IV, MT-CO1 displayed significant hypomethylation: methylation at site 1 of MT-CO1 was markedly reduced in the hypospadias group compared with the control group (Figure 4A). In contrast, no statistically significant difference in methylation was detected for MT-CO3 between the two groups (Figure 4B). In addition, both interrogated regions within MT-RNR2 exhibited a significant hypomethylation phenotype in the hypospadias group (Figure 4C,4D). Conversely, MT-ND6 showed significantly increased methylation levels in the hypospadias group relative to the control group (Figure 4E), suggesting an epigenetic regulatory pattern distinct from that of MT-CO1 and MT-RNR2. These findings further support the presence of a potentially complex relationship between mtDNA methylation and the expression of mitochondrial energy metabolism-related genes.

Figure 4 Site-specific methylation levels of mitochondrial genes in preputial tissue from patients with different hypospadias subtypes. Methylation levels at specific sites within each gene region were quantified using bisulfite pyrosequencing. (A) Methylation levels at the MT-CO1-specific site. (B) Methylation levels at the MT-CO3-specific site. (C) Methylation levels in MT-RNR2 segment 1. (D) Methylation levels in MT-RNR2 segment 2. (E) Methylation levels at the MT-ND6-specific site. *, P<0.05; ***, P<0.001; ****, P<0.0001; ns, not significant.

To further clarify whether these mtDNA methylation abnormalities correlate with clinical subtyping of hypospadias, methylation sites were stratified and compared across the distal, intermediate, and proximal subtypes. The characteristic patterns of MT-CO1 and MT-RNR2 hypomethylation and MT-ND6 hypermethylation were consistently observed across all three subtypes, with no statistically significant differences between the subgroups (all P values >0.05) (Figure 5). These results suggest that the observed mtDNA methylation alterations are unlikely to be subtype-specific; instead, they may represent a shared epigenetic feature across hypospadias subtypes during disease development and progression.

Figure 5 Comparison of methylation levels of mitochondrial genes among different hypospadias subtypes. Methylation levels at selected sites within each gene region were quantified using bisulfite pyrosequencing. (A) Methylation levels at differentially methylated sites of MT-CO1. (B) Methylation levels at differentially methylated sites of MT-RNR2. (C) Methylation levels at differentially methylated sites of MT-ND6. ns, not significant.

Discussion

Hypospadias is recognized as one of the most prevalent congenital anomalies in male neonates, and its global incidence has risen by about 1.6 times in recent decades (2). Treatment of hypospadias requires intricate reconstructive surgery, resulting in considerable physical strain for patients and long-term psychological pressure on their families (25,26). Therefore, elucidating the causes of hypospadias holds substantial relevance for both clinical practice and public health. Although hypospadias exhibits familial aggregation and heritable risk from both paternal and maternal sides (5), traditional genetic analyses, such as those examining single-gene mutations and chromosomal abnormalities, cannot account for all cases. In recent years, a growing body of epidemiological evidence has linked an increasing abundance of environmental exposures to the rising incidence of hypospadias (27,28). Importantly, environmental exposures, including endocrine disruptors, seldom cause DNA sequence alterations directly yet are capable of inducing long-lasting epigenetic changes (3,29). As a central epigenetic mechanism, DNA methylation serves as a critical link between environmental exposures and gene expression control, with abnormal patterns in preputial tissues of patients with hypospadias being documented in several studies (11). These findings suggest that dysregulation of DNA methylation may represent an important molecular basis underlying the multifactorial etiology of hypospadias. Furthermore, evidence from toxicological research and animal models suggests that hypospadias development is associated with mitochondrial dysfunction and increased oxidative stress (19,20). Nevertheless, as a genetic material independent of nuclear chromosomes, the mechanisms of mtDNA methylation and its role in hypospadias remain insufficiently understood. Against this background, our study integrated transcriptomic and methylation data to systematically investigate the methylation status of key mtDNA regions in hypospadias, with the aim of determining their epigenetic regulatory roles in disease development.

A hallmark clinical feature of hypospadias is the abnormal development of the penile foreskin, typically characterized by dorsal hooded redundancy and ventral deficiency (30). Preputial tissue shares a common embryological origin and anatomical proximity with urethral structures, making it a practical and ethically accessible surrogate for investigating molecular alterations associated with urethral development. It may harbor molecular information reflective of developmental disturbances, which may partially contribute to the development of hypospadias. Accordingly, this study collected preputial samples from boys with phimosis and from patients diagnosed with distal, midshaft, and proximal hypospadias for further investigation. Notably, a significant age difference was observed between the control and hypospadias groups, which reflects real-world clinical practice. Given that age can influence both gene expression and epigenetic patterns, it may act as a potential confounding factor in this study. However, the age distribution within the hypospadias group was highly concentrated, which may partially reduce the confounding effect.

Using RNA-seq in combination with comprehensive bioinformatic analyses, we first identified potential disease-associated factors within the foreskin samples. Relative to the control group, 9 genes were downregulated and 87 genes were significantly upregulated in the hypospadias group. Functional enrichment analysis based on GO analysis demonstrated that processes related to mitochondrial aerobic respiration and energy metabolism were markedly affected. Furthermore, KEGG pathway analysis revealed that OXPHOS and ROS production were the most significantly altered pathways. Collectively, these results suggest that hypospadias formation may be closely linked to dysregulated mitochondrial gene expression, a conclusion corroborated by subsequent GSEA, which identified significant positive enrichment of OXPHOS and ATP synthesis-coupled electron transport.

OXPHOS is a mitochondrial electron transport process tightly coupled to ATP synthesis and constitutes the central pathway of aerobic respiration responsible for producing ATP, the immediate energy source for cellular activities (31). However, this efficient bioenergetic process is inherently associated with oxidative stress, as electron leakage from the electron transport chain occurs even during normal operation, leading to the formation of ROS, including superoxide radicals, through reactions with molecular oxygen (32). Previous studies have suggested that excessive activation of OXPHOS may result in mitochondrial hyperpolarization and increased ROS accumulation, subsequently causing mitochondrial dysfunction, exacerbation of oxidative stress, and eventual induction of apoptosis (33,34). In addition, prolonged oxidative stress can impair the epithelial-mesenchymal transition of urethral epithelial cells (23) and promote nonapoptotic cell death pathways, such as autophagy (35) and necroptosis (36). Taken together, these observations underscore the importance of maintaining homeostasis in mitochondrial OXPHOS and ATP synthesis-coupled electron transport for preserving cellular energy and redox equilibrium, further suggesting that disruption of this balance may be a critical molecular contributor to the pathogenesis of hypospadias.

Building upon the mechanism-related findings described above, we next concentrated on mitochondrial genes that are likely to play pivotal roles in the development and progression of hypospadias. Comparative profiling of mitochondrial gene expression in distal, midshaft, and proximal hypospadias tissues indicated a uniform upregulated expression of mitochondrial genes across all three subtypes. Among these, only four genes—MT-CO1, MT-CO3, MT-RNR2, and MT-ND6—exhibited significant differential expression consistently in all subtypes, indicating that they may represent central regulatory nodes underlying the shared pathogenic features of hypospadias. These genes are fundamental to mitochondrial functional maintenance and are tightly linked to the stability of the OXPHOS pathway. MT-CO1 and MT-CO3 encode essential subunits of mitochondrial respiratory chain complex IV and jointly facilitate the terminal electron transfer reactions of OXPHOS (37,38). MT-ND6, which encodes the sixth subunit of OXPHOS complex I, is indispensable for preserving complex I structural integrity and electron transfer efficiency, thereby acting as a critical component for initiating electron flux throughout the OXPHOS system (39). Moreover, MT-RNR2 encodes the 16S ribosomal RNA of the mitochondrial large ribosomal subunit; as the mitochondrial ribosome is the sole site for translation of mtDNA-encoded OXPHOS subunits, MT-RNR2 can influence mitochondrial energy metabolism indirectly by regulating de novo synthesis and the functional assembly of OXPHOS complexes I, III, IV, and V (40).

Despite accumulating evidence implicating mitochondrial dysfunction in hypospadias, the link between mtDNA epigenetic regulation and disease pathogenesis remains incompletely understood. To preliminarily assess whether the aberrant expression of the four key genes identified above (MT-CO1, MT-CO3, MT-RNR2, and MT-ND6) is associated with alterations in their methylation status, we analyzed global mtDNA methylation data from the GSE200681 (11) dataset. This analysis revealed a pronounced tendency toward decreased methylation levels across the DNA regions corresponding to these four genes in patients with distal hypospadias. However, as the methylation matrix of this dataset reflects methylation levels at 1,000-bp intervals, it lacks sufficient resolution to precisely characterize the methylation status of specific target genes. To overcome this technical limitation, we subsequently employed targeted pyrosequencing to accurately quantify DNA methylation levels at certain loci within the genes of interest. In partial agreement with the initial findings, methylation levels of MT-CO1 and MT-RNR2 were significantly decreased in the hypospadias group as compared with the control group and were inversely correlated with their elevated expression levels; meanwhile, MT-CO3 demonstrated no significant difference in methylation between the groups. Intriguingly, MT-ND6 exhibited significantly increased methylation in the hypospadias group, revealing a regulatory pattern completely opposite to that observed for MT-CO1 and MT-RNR2. This unexpected pattern may reflect the non-canonical regulatory nature of mtDNA. Unlike nuclear DNA, mtDNA lacks histone-based chromatin organization, and methylation may influence transcription indirectly through mitochondrial genome stability, replication dynamics, or transcriptional efficiency rather than acting as a direct repressive signal (41). Alternatively, the observed hypermethylation of MT-ND6 may represent a compensatory or context-dependent response under conditions of mitochondrial stress. These possibilities highlight the complexity of mtDNA epigenetic regulation and warrant further investigation. Further analyses indicated that these aberrant methylation patterns did not differ significantly across the distal, midshaft, and proximal hypospadias subtypes. Therefore, the aberrant methylation of these mitochondrial genes may represent a potentially shared epigenetic feature independent of clinical subtype, although this observation requires further validation in larger cohorts.

Although direct evidence linking mitochondrial gene DNA methylation to transcriptional regulation remains limited, mtDNA methylation, as a key epigenetic modification, is essential to maintaining mitochondrial genome stability, regulating gene expression, and preserving mitochondrial functional homeostasis (42). Aberrant mtDNA methylation has been strongly implicated in a variety of pathological processes, including diabetes, cardiovascular diseases, and neurodegenerative disorders (43,44). Environmental factors, particularly EDCs, have also been increasingly implicated in the etiology of hypospadias and may influence mtDNA methylation patterns, thereby acting as upstream regulators of mitochondrial gene expression and function. To our knowledge, our study is the first to discover a significant association between mtDNA methylation abnormalities and hypospadias and to identify a characteristic methylation pattern consisting of the hypomethylation of MT-CO1 and MT-RNR2 together with the hypermethylation of MT-ND6. These findings provide a novel molecular perspective for understanding the multifactorial etiology of hypospadias. Specifically, they suggest that environmental and other external factors may induce site-specific mtDNA methylation disturbances, thereby disrupting the expression of key genes involved in the OXPHOS pathway, impairing mitochondrial energy metabolism and redox balance, and ultimately leading to the urethral epithelial cell dysfunction that contributes to disease development (Figure 6). It should be noted, however, that this study did not directly validate the functional consequences of these methylation alterations on mitochondrial function or penile development through experimental approaches, which represents an important direction for future investigations.

Figure 6 Schematic model illustrating the proposed mechanism linking mtDNA methylation alterations to mitochondrial dysfunction and the development of hypospadias. Environmental factors may induce site-specific mtDNA methylation changes, including hypomethylation of MT-CO1 and MT-RNR2 and hypermethylation of MT-ND6. These alterations may affect the expression of key mitochondrial genes, leading to OXPHOS dysregulation, impaired energy metabolism, and increased ROS production. The resulting mitochondrial dysfunction may contribute to urethral epithelial cell impairment and the pathogenesis of hypospadias. mtDNA, mitochondrial DNA; OXPHOS, oxidative phosphorylation; ROS, reactive oxygen species.

Limitations

Several limitations of this study should be acknowledged. The RNA-seq cohort was relatively small, which may limit statistical power and increase the risk of false-positive findings. In addition, the age difference between the control and hypospadias groups may introduce potential confounding effects, although within-group age variability in the hypospadias cohort was limited.

The use of preputial tissue, while practical and anatomically relevant, does not fully represent urethral epithelial tissue. Moreover, the relatively small sample size within each clinical subtype limits the strength of conclusions regarding subtype-specific differences or shared mechanisms.

Furthermore, due to differences in sample sources, direct correlation analysis between DNA methylation and gene expression was not performed. Finally, this study lacks functional validation; therefore, the findings should be interpreted as associative, and further studies are required.


Conclusions

By integrating transcriptomic analyses with multi-level DNA methylation validation, this study systematically demonstrated, for the first time, a significant association between the epigenetic dysregulation of key mitochondrial energy metabolism genes—MT-CO1, MT-RNR2, and MT-ND6—and the pathogenesis of hypospadias. Our results revealed that MT-CO1 and MT-RNR2 exhibit marked hypomethylation, whereas MT-ND6 appears to have increased methylation levels in the preputial tissues of patients with hypospadias. Furthermore, this methylation pattern appeared to be similar across different clinical subtypes, including distal, midshaft, and proximal hypospadias. These findings suggest that aberrant mtDNA methylation may act as a shared epigenetic driver in hypospadias by disrupting the integrity of the OXPHOS pathway, impairing mitochondrial energy metabolic homeostasis and promoting oxidative stress. Collectively, this study provides novel insights into the multifactorial etiology of hypospadias from a mitochondrial epigenetic perspective and highlights mtDNA methylation as a potential molecular basis for risk assessment and early intervention. From a clinical perspective, these methylation patterns may serve as candidate biomarkers for hypospadias; however, their practical application will require further validation in larger, independent cohorts, as well as evaluation of their detectability in minimally invasive samples.


Acknowledgments

None.


Footnote

Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://tau.amegroups.com/article/view/10.21037/tau-2026-0251/rc

Data Sharing Statement: Available at https://tau.amegroups.com/article/view/10.21037/tau-2026-0251/dss

Peer Review File: Available at https://tau.amegroups.com/article/view/10.21037/tau-2026-0251/prf

Funding: This study was supported by the Tianjin Key Medical Discipline (Specialty) Construction Project (No. TJYXZDXK-040A), the National Science Fund for Excellent Young Scholars (No. 82322038), and the Key Project of Tianjin Municipal Science and Technology Plan (No. 22JCZDJC00230).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://tau.amegroups.com/article/view/10.21037/tau-2026-0251/coif). All authors report grants from the Tianjin Key Medical Discipline (Specialty) Construction Project (No. TJYXZDXK-040A), the National Science Fund for Excellent Young Scholars (No. 82322038), and the Key Project of Tianjin Municipal Science and Technology Plan (No. 22JCZDJC00230). The authors have no other conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Ethics Committee of Tianjin Children’s Hospital (approval No. 2022-SYYJCYJ-006) and informed consent was taken from patients’ parents or legal guardians.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.


References

  1. van der Horst HJ, de Wall LL. Hypospadias, all there is to know. Eur J Pediatr 2017;176:435-41. [Crossref] [PubMed]
  2. Yu X, Nassar N, Mastroiacovo P, et al. Hypospadias Prevalence and Trends in International Birth Defect Surveillance Systems, 1980-2010. Eur Urol 2019;76:482-90. [Crossref] [PubMed]
  3. Skakkebaek NE, Rajpert-De Meyts E, Buck Louis GM, et al. Male Reproductive Disorders and Fertility Trends: Influences of Environment and Genetic Susceptibility. Physiol Rev 2016;96:55-97. [Crossref] [PubMed]
  4. George M, Schneuer FJ, Jamieson SE, et al. Genetic and environmental factors in the aetiology of hypospadias. Pediatr Surg Int 2015;31:519-27. [Crossref] [PubMed]
  5. Schnack TH, Zdravkovic S, Myrup C, et al. Familial aggregation of hypospadias: a cohort study. Am J Epidemiol 2008;167:251-6. [Crossref] [PubMed]
  6. Dave S, Liu K, Clark R, et al. A retrospective population-based cohort study to evaluate the impact of an older sibling with undescended testis and hypospadias on the known maternal and fetal risk factors for undescended testis and hypospadias in Ontario, Canada, 1997-2007. J Pediatr Urol 2019;15:41.e1-9. [Crossref] [PubMed]
  7. Joodi M, Amerizadeh F, Hassanian SM, et al. The genetic factors contributing to hypospadias and their clinical utility in its diagnosis. J Cell Physiol 2019;234:5519-23. [Crossref] [PubMed]
  8. Geller F, Feenstra B, Carstensen L, et al. Genome-wide association analyses identify variants in developmental genes associated with hypospadias. Nat Genet 2014;46:957-63. [Crossref] [PubMed]
  9. S Y. The possible role of epigenetics in the etiology of hypospadias. J Pediatr Urol 2024;20:877-83. [Crossref] [PubMed]
  10. Richard MA, Sok P, Canon S, et al. Altered mechanisms of genital development identified through integration of DNA methylation and genomic measures in hypospadias. Sci Rep 2020;10:12715. [Crossref] [PubMed]
  11. Kaefer M, Rink R, Misseri R, et al. Role of epigenetics in the etiology of hypospadias through penile foreskin DNA methylation alterations. Sci Rep 2023;13:555. [Crossref] [PubMed]
  12. Zhang Y, Jia H, Fan J, et al. Mono-2-ethylhexyl phthalate-induced downregulation of MMP11 in foreskin fibroblasts contributes to the pathogenesis of hypospadias. Ecotoxicol Environ Saf 2024;284:116988. [Crossref] [PubMed]
  13. Guerrero-Bosagna C, Skinner MK. Environmentally induced epigenetic transgenerational inheritance of male infertility. Curr Opin Genet Dev 2014;26:79-88. [Crossref] [PubMed]
  14. Jones MJ, Goodman SJ, Kobor MS. DNA methylation and healthy human aging. Aging Cell 2015;14:924-32. [Crossref] [PubMed]
  15. Moore LD, Le T, Fan G. DNA methylation and its basic function. Neuropsychopharmacology 2013;38:23-38. [Crossref] [PubMed]
  16. Greenberg MVC, Bourc’his D. The diverse roles of DNA methylation in mammalian development and disease. Nat Rev Mol Cell Biol 2019;20:590-607. [Crossref] [PubMed]
  17. Zhang Y, Wang J, Yang H, et al. The potential mechanisms underlying phthalate-induced hypospadias: a systematic review of rodent model studies. Front Endocrinol (Lausanne) 2024;15:1490011. [Crossref] [PubMed]
  18. Vottero A, Minari R, Viani I, et al. Evidence for epigenetic abnormalities of the androgen receptor gene in foreskin from children with hypospadias. J Clin Endocrinol Metab 2011;96:E1953-62. [Crossref] [PubMed]
  19. Chen Y, Hu J, Peng L, et al. DNMT1 targets SRD5A2 to induce mitochondrial homeostasis and EMT in urothelial cells of hypospadias. Mol Biol Rep 2025;52:356. [Crossref] [PubMed]
  20. Arowolo O, Pilsner JR, Sergeyev O, et al. Mechanisms of Male Reproductive Toxicity of Polybrominated Diphenyl Ethers. Int J Mol Sci 2022;23:14229. [Crossref] [PubMed]
  21. Han X, Huang Q. Environmental pollutants exposure and male reproductive toxicity: The role of epigenetic modifications. Toxicology 2021;456:152780. [Crossref] [PubMed]
  22. Liu J, Cheng Y, Huang E, et al. Estrogen receptor 1 (ESR1) promotes Di-butyl phthalate (DBP)-induced hypospadias by regulating mitophagy through PINK1-Parkin axis to inhibit ferroptosis. Reprod Toxicol 2025;137:109036. [Crossref] [PubMed]
  23. Zhu YP, Zhao W, Sun WL, et al. Di-n-butyl phthalate (DBP) reduces epithelial-mesenchymal transition via IP3R in hypospadias during maternal exposure. Ecotoxicol Environ Saf 2020;192:110201. [Crossref] [PubMed]
  24. Shi B, He E, Chang K, et al. Genistein prevents the production of hypospadias induced by Di-(2-ethylhexyl) phthalate through androgen signaling and antioxidant response in rats. J Hazard Mater 2024;466:133537. [Crossref] [PubMed]
  25. Roen K. Hypospadias surgery: understanding parental emotions, decisions and regrets. Int J Impot Res 2023;35:67-71. [Crossref] [PubMed]
  26. Liu B, Li S, Xu Y, et al. The mediating effects of parental hope and psychological resilience on social support and decision conflict in children with hypospadias. J Pediatr Urol 2025;21:154-9. [Crossref] [PubMed]
  27. van der Zanden LF, van Rooij IA, Feitz WF, et al. Aetiology of hypospadias: a systematic review of genes and environment. Hum Reprod Update 2012;18:260-83. [Crossref] [PubMed]
  28. Das D, Dutta HK, Borbora D, et al. Assessing the relationship between hypospadias risk and parental occupational exposure to potential endocrine-disrupting chemicals. Occup Environ Med 2023;80:93-6. [Crossref] [PubMed]
  29. Cavalli G, Heard E. Advances in epigenetics link genetics to the environment and disease. Nature 2019;571:489-99. [Crossref] [PubMed]
  30. Matsushita S, Suzuki K, Murashima A, et al. Regulation of masculinization: androgen signalling for external genitalia development. Nat Rev Urol 2018;15:358-68. [Crossref] [PubMed]
  31. Greene J, Segaran A, Lord S. Targeting OXPHOS and the electron transport chain in cancer; Molecular and therapeutic implications. Semin Cancer Biol 2022;86:851-9. [Crossref] [PubMed]
  32. Aranda-Rivera AK, Cruz-Gregorio A, Aparicio-Trejo OE, et al. Mitochondrial Redox Signaling and Oxidative Stress in Kidney Diseases. Biomolecules 2021;11:1144. [Crossref] [PubMed]
  33. León M, Prieto J, Molina-Navarro MM, et al. Rapid degeneration of iPSC-derived motor neurons lacking Gdap1 engages a mitochondrial-sustained innate immune response. Cell Death Discov 2023;9:217. [Crossref] [PubMed]
  34. Jin J, Qiu S, Wang P, et al. Cardamonin inhibits breast cancer growth by repressing HIF-1α-dependent metabolic reprogramming. J Exp Clin Cancer Res 2019;38:377. [Crossref] [PubMed]
  35. Zhao S, Pan L, Chen M, et al. Di-n-butyl phthalate induced autophagy of uroepithelial cells via inhibition of hedgehog signaling in newborn male hypospadias rats. Toxicology 2019;428:152300. [Crossref] [PubMed]
  36. Wu L, Xie Z, Li T, et al. Prenatal exposure to di-n-butyl phthalate promotes RIPK1-regulated necroptosis of uroepithelial cells and induces hypospadias through the epithelial-mesenchymal transition process in newborn male rats. Toxicology 2024;509:153982. [Crossref] [PubMed]
  37. Rousseau DL, Ishigami I, Yeh SR. Structural and functional mechanisms of cytochrome c oxidase. J Inorg Biochem 2025;262:112730. [Crossref] [PubMed]
  38. Yoshikawa S, Shimada A. Reaction mechanism of cytochrome c oxidase. Chem Rev 2015;115:1936-89. [Crossref] [PubMed]
  39. Okoye CN, Koren SA, Wojtovich AP. Mitochondrial complex I ROS production and redox signaling in hypoxia. Redox Biol 2023;67:102926. [Crossref] [PubMed]
  40. Li S, Pan H, Tan C, et al. Mitochondrial Dysfunctions Contribute to Hypertrophic Cardiomyopathy in Patient iPSC-Derived Cardiomyocytes with MT-RNR2 Mutation. Stem Cell Reports 2018;10:808-21. [Crossref] [PubMed]
  41. Smith ZD, Meissner A. DNA methylation: roles in mammalian development. Nat Rev Genet 2013;14:204-20. [Crossref] [PubMed]
  42. Martínez-Reyes I, Chandel NS. Mitochondrial TCA cycle metabolites control physiology and disease. Nat Commun 2020;11:102. [Crossref] [PubMed]
  43. Stoccoro A, Coppedè F. Mitochondrial DNA Methylation and Human Diseases. Int J Mol Sci 2021;22:4594. [Crossref] [PubMed]
  44. Zhang XX, Wei M, Wang HR, et al. Mitochondrial dysfunction gene expression, DNA methylation, and inflammatory cytokines interaction activate Alzheimer’s disease: a multi-omics Mendelian randomization study. J Transl Med 2024;22:893. [Crossref] [PubMed]

(English Language Editor: J. Gray)

Cite this article as: Yang H, Wang J, Zhang Y, Wang W, Guo L, Shi S, Zhang Z, Guan Y, Cui H. Aberrant methylation of mitochondrial genes as a link between oxidative phosphorylation dysregulation and the pathogenesis of hypospadias: a multiomics and clinical sample study. Transl Androl Urol 2026;15(4):134. doi: 10.21037/tau-2026-0251

Download Citation